ZFIN ID: ZDB-TSCRIPT-091110-1139
Transcript Name: grpel2-002
Previous Names: dkey-25l11.3-002, ch211-247j9.1-001, si:dkey-25l11.3-002

Add new Alias

Alias
Attribution

Attributions for Alias: {{control.newAlias}}

{{pub.zdbID}}

Delete Alias:

(Including Attributions)
Transcript Type: ncRNA
Annotation Status: retained intron
Strain: TU
Non Reference Strains:
Associated with Genes:
SEQUENCE
OTTDART00000044061 (1) [ Show ] (double-click sequence to select) [Download]
Select Analysis Tool
>tpe|OTTDART00000044061|OTTDARG00000031631|ZDB-GENE-091204-188 grpel2|no_translation DKEY-25L11.3-002 LG_ CR749164.18 Danio rerio protein_coding NOVEL, 852 bp
CGAGAAGAAATCCGATCGATCTGTGCAGGTTAACACCAAG
TGCGGTCACCAGGTCTGCCGTAGGCCTCTTTAGCACTGCG
GCAGAGCAGCGTAGTGCTGGTGACGACTGCCATGGTGAAG
ACAGAGATGACGACCACAGTCATGCCGTCACACACGTCCG
GACCCTTGAGATGAGAGCCAGAAAACTGGAGGAGCAGGTT
CACGACCTCACCGAGCGATACAAGCGAGCCGTTGCAGACT
CAGACAATGTTAGAAGAAGAACACAGAAATTTGTAGAGGA
CGCCAAATTGTTTGGTAATAACTAACTATACACTTAATGC
ACGCATACCTTGGTGTCTCGTAAATCTCTCAGTTCCACAT
TAAGCATAATTGTCCTCCTGCAGGGATTCAGAGTTTCTGC
CGTGACCTGGTAGAAGTGGCAGACCTTCTGGAGAAGAACT
TGACGGTTGAGGAGAGCGATGGAGCACAGCAGCTGGCACA
ATACCTGGCACACATTCAAGAGCGGCTGCAGGACATCTTC
ACCAAGCACGGACTGGAGAAGATGACCCCTGTGGGAACCA
CATATGACCCCTATCAGCACGAAATCGTCTGCCATACTCC
AGCCGAGGGAGCGGAGCCTGGAACCATCGCCATGGTCAAG
CAAGACGGTTACATGCTTCACGGACGCACCATTCGCCATG
CCCTCGTGGGTATCGCTGTCAAAACTCAAGAGCGGTGACA
GGACTTTTGTTCACTTCTTGTCCCGCTAATGTTTTTGTAC
ACTCATAGTTTGTACGATGCTATTGTTCTTACATCTCTAG
ACGACTACATGTTTGACTTACTCTTTGAAGTAATGGTTAT
TTATATGTATTT

grpel2 TRANSCRIPTS
Type Name Length (bp) Analysis
ncRNA grpel2-002 852
mRNA grpel2-201 (1) 886
SEGMENT (CLONE AND PROBE) RELATIONSHIPS
grpel2-002 Contained in:
OTHER grpel2-002 TRANSCRIPT PAGES
  • Vega_Trans:OTTDART00000044061 (1)
  • PROTEIN PRODUCTSNo links to external site
    ZEBRAFISH SUPPORTING SEQUENCES
    Type Accession # Length (bp/aa) Analysis
    RNA GenBank:CT659415 (1) 859bp
    GenBank:CT659380 (1) 852bp
    CITATIONS (1)