ZFIN ID: ZDB-TSCRIPT-091110-1111
Transcript Name: atp5mea-201
Previous Names: atp5ia-001, dkey-30k6.4-001, ch211-191j22.5-001

Add new Alias

Alias
Attribution

Attributions for Alias: {{control.newAlias}}

{{pub.zdbID}}

Delete Alias:

(Including Attributions)
Transcript Type: mRNA
Annotation Status:
Strain: TU
Non Reference Strains:
Associated with Genes:
SEQUENCE
OTTDART00000043948 (1) [ Show ] (double-click sequence to select) [Download]
Select Analysis Tool
>tpe|OTTDART00000043948|OTTDARG00000031566|ZDB-GENE-070928-12 atp5ia|OTTDARP00000034832 DKEY-30K6.4-001 LG_ AL844141.7 Danio rerio protein_coding NOVEL, 557 bp
AGATGCTGATGTAGTGTGCTGACAGTGAAGACGCTGAAAT
CAAAGGCGAGAGCAGGGACAACAGACTGACAGCGCCGCAC
TGACTTCTTCCTGCCTGAAGAGACCGATTCAAACATGGTT
CCTCCTGTACAGGTCTCCCCTCTTATCAAGACTGCAAGAT
GGTCTGCCTTGCTCATTGGGTTGATTTATGGGAAGCAAAG
ATATGATTACCTGAAGCCCATTGCTGCTGAAGAGAGGAGG
ATTGAGGAGGAAGAGAAGAAGCTGAGGGAAGAACAAGAGC
GCATTTACAAACAGCTTTCTGAAGCAAACTCTGACACCAT
TTTGAAGTAAATCCCCACGATGTATCCATTCCAGCACTAA
ATGAGATGAACCACAATGAACCTAATTCTATTTTTCAATA
AAGACAGAAGTTAAAAATATATCATTTCTTTTTCTTTTAT
TTACCATTTAATTCAGATTATATGCACCACTTCTCCATTC
ATTTTCCAAAAAAACATTTGATTTGATTACATTTGTGTAC
ATCTGACAGAAGTAAATAATTCTGTATGTGTTGAAGA

GBrowse:
SEGMENT (CLONE AND PROBE) RELATIONSHIPS
atp5mea-201 Contained in:
[BAC] DKEY-30K6 (1) (order this)

Genome Resources: Vega_Trans:OTTDART00000043948 (1),  Ensembl_Trans:ENSDART00000115236 (1)
PROTEIN PRODUCTS No links to external site
ZEBRAFISH SUPPORTING SEQUENCES
Type Accession # Length (bp/aa) Analysis
RNA GenBank:EH443231 (1) 552 bp
GenBank:EH469116 (1) 536 bp
GenBank:EH589989 (1) 488 bp
GenBank:EH607464 (1) 468 bp
GenBank:BC152574 (1) 434 bp
CITATIONS (2)