header logo image header logo text
Downloads Login
Research
General Information
ZIRC
ZFIN ID: ZDB-TSCRIPT-091110-1101
Transcript Name: si:ch211-203l7.3-002
Previous Names: ch211-203l7.3-002, ch211-262i10.2-001

Add new Alias

Alias
Attribution

Attributions for Alias: {{control.newAlias}}

{{pub.zdbID}}

Delete Alias:

(Including Attributions)
Transcript Type: lincRNA
Annotation Status:
Strain: TU
Non Reference Strains:
Associated with Genes:
SEQUENCE
OTTDART00000043916 (1) [ Show ] (double-click sequence to select) [Download]
Select Analysis Tool
>tpe|OTTDART00000043916|OTTDARG00000031535|ZDB-GENE-091204-366 si:ch211-203l7.3|no_translation CH211-203L7.3-002 LG_ BX000991.8 Danio rerio lincRNA NOVEL, 820 bp
GTGTGACCTTTTAATTCCAGTGTTAAGTTCTTTATTGCAA
GCGTTCTTGTTTTTCAGTTTAATTTCTAATGTTACACAGC
TCTGCTTTTAGTTTTTACAAAACAAATGAATTCAAATCTA
CTCGAAATACATCTTCAAACACCTCTGCTGCATAAAAAGG
CGCAAGATTAAGAAAATAATCCACCAGCCCGTATGCTGCA
GTTCCCAGGCTCCGTGACAGTGGGTTTTTCTCCACACACA
TCTTCATCTGTGGCCCTGGGTGTTTATGGAGTGGAAAGTG
CAGGCCTGCTCTCAAAGTGAATTGAAGTCTTCGTGTCCTG
TGCACCTGAATAAAAGGATGTGAAGTTTCAGACTGATGAC
CGCTTGGACAGTGTTCATCTCCTGTCGGTCACTTGCAATT
CGTTTGAAATGAGACTCTTGTTTGGCCTATAAGCTTCACC
ACCCCTTAGCCCTGCACAAAAGCACAGAACTGGGAGGCAA
AGGAAGTGAAGAGAGAAAGGCCACCTTCAGTCTATGTGTG
CATGAATCGTAGAGATCCATTAAATCTATTTCACCGGCTT
TCCTTGGTACTCCATACATAAGCACCCAGCCTAAATTCCC
CCCATAGTGACTCAGTGAAAGGGAGCCGGGATGAATAGCA
CACTTTATTGGAGCATGCCATGAGTGGTCAAACAGCAGTG
GCGGGCCCATTCTTCGCCCCTTCAGGCCATTATTAAAAAG
GGCTTTACGGAGCCTTGTAAAAGTGTTCTCTCCTCAGGGG
GCCTGCATAATAAAAATCGAAGTCAAATTAAAGCCCCGCG
GAGCAAAGAACTGTGGGTGG

si:ch211-203l7.3 TRANSCRIPTS
Type Name Length (bp) Analysis
lincRNA si:ch211-203l7.3-001 (1) 573
si:ch211-203l7.3-002 820
SEGMENT (CLONE AND PROBE) RELATIONSHIPS
si:ch211-203l7.3-002 Contained in:

OTHER si:ch211-203l7.3-002 TRANSCRIPT PAGES
  • Vega_Trans:OTTDART00000043916 (1)
  • PROTEIN PRODUCTS No links to external site
    ZEBRAFISH SUPPORTING SEQUENCES
    Type Accession # Length (bp/aa) Analysis
    RNA GenBank:CV488283 (1) 820 bp
    GenBank:DT876747 (1) 767 bp
    GenBank:CN178271 (1) 762 bp
    CITATIONS (1)