ZFIN ID: ZDB-TSCRIPT-091110-1094
Transcript Name: si:dkeyp-69c1.6-201
Previous Names: ch211-203l7.2-003, dkeyp-69c1.6-001, ottdart00000043891, si:dkeyp-69c1.6-001

Add new Alias

Alias
Attribution

Attributions for Alias: {{control.newAlias}}

{{pub.zdbID}}

Delete Alias:

(Including Attributions)
Transcript Type: mRNA
Annotation Status:
Strain: TU
Non Reference Strains:
Associated with Genes:
SEQUENCE
OTTDART00000043891 (1) [ Show ] (double-click sequence to select) [Download]
Select Analysis Tool
>tpe|OTTDART00000043891|OTTDARG00000031524|ZDB-GENE-030131-6333 si:dkeyp-69c1.6|OTTDARP00000034788 DKEYP-69C1.6-001 LG_ BX510940.8 Danio rerio protein_coding NOVEL, 1782 bp
GACGCCATAAATAAACAAGATGGCTGCTTCCACTGGCATT
AGCAAAGGCGCTGCGCTCAGTAAAGCAGATTATCTTAAAC
GTTATTTATCAAATGATGAAGCTGATAAAAAATCTAAAGA
AAAGAAGGTTAAGAAGAAGCGACCAAAACCTTCTGGAAAA
GGGATGAAAATTGTGGATGATGATATTGACTGGAGGCAAC
TGGCGGCTCGCGAAGAAGAAAATAAAGAAGATGATGAAGA
AGAAGATGAGGCGCCTGTGGTTGCAGAAGTGATTGATGAA
CGCCCTGATGAGATTAAGCAGTTTGAGGCGTTCAAAACCA
GCAAGTGGAGAGTGATGGGTGCAACGGGGGAAGATCTTCA
GGAAAACGAGGAGTCTACATTCAATAGAAGCTCAGACACT
GATAAAGGTCATAGACTGCGACATGATTCACCAGAGGGAT
CTTCTGTCCGAAAAGTGCGTCATGATTCCCCTGACCTCTC
ACCTAAAAGGGCTCGCCACGACTCTCCTGACCTTTCACCT
CCAAAAAAAGGTCGCCACGACTCCCCTGACCTCTCACCTC
AAAGACCCAAAACAGAGAATAAAAACAGGCGGCACGACTC
CTCGTCACCTTCTCCTCCAAGACTAAGCCACATAAGCACA
CCCTCTAGAACTCAAAGGCATCATGACAAGGGGTCCACAC
ATAGAAAAAAGATGAAAGGCTCTTCTTCAGGTGATCTTTC
GCCGCCCAGGAGACGAGACCGGACGGGCAAAGGCTCAGAC
TCAGATCAGTCCCCACCGCGCAGGCGTCCTCATGGGCGAC
GAGGTTTAGACTCCGATCTATCTCCACCCAGAAAGAGGGG
CCATGGTGGTGGAGGTTCAGATTCAGATCTCTCTCCTCCC
AGGAAGAGGGTACAGGGGGGACAGGGATCAGATTCAGATC
TGTCTCCACCACGGAGGACACGCTCTCCTGATGGACAAGC
TGCTCCTCGAATGCTGTCTGGTGGTGCTGCAGGTCTCGTC
TCTGTGGACATTTTAAGGAAAGAACAGGAAGAAATTCGTA
GAAGGGAAAAGCGCAACCAGCCTCTAGAAGAGGCATCCAG
AAATGCAGAGACAATATTTCGAGACAAGTCCGGTCGGAAA
CGTAACCTTGAGTCAGAAAAGGCTGAGCTTAGTCAGAAAG
CTTCAGAGAAGGCTGAGAAGGATGAAAAATATGCACAGTG
GGGAAAAGGTCTCGCTCAGGGTGAAATGCAGGAGCAGAAT
GTGATCGATGCCATACGGGAAGCCGAGAAGCCATTAGCGA
GACACATTGACGATGAAGACCTTGATCGCATGCTAAGAGA
GCAAGAGAGAGAAGGAGACCCAATGGCGGCAATGCTTCGC
AAGAAGAAAGACAAAACTGCTAAATTAAAAGGAGTCAAAG
AAAAACCTTGTTACAAGGGTCCACCCCCACCTCCAAACCG
TTTTAACATTATGCCAGGGTATCGGTGGGATGGGGTTGAC
AGGTCCAACGGTTTTGAGCAGAAGCGATACTCCAGAATGG
CCGATAACAAAGCTGTCCAAGAGATGGCGTACAAGTGGAG
TGTTGAAGACATGTAGATGTTCCTAAAGATGCAGATTTGG
GTACAGAGAATGTAAATGCTGACATTCGTACGGTTCCCGC
TGCACCTGCTCATGCTGCAAAGTGGAAGTTGTTTGTGTGC
CATCAAAAACTGGGACGTTAGATCAAAAAGCAACATTTTG
TTCAAGTTTATCAATCCTACAAGAAACATACCTTCCTTAT
TAAATGCTACTTTTTTAACAAA

SEGMENT (CLONE AND PROBE) RELATIONSHIPS
si:dkeyp-69c1.6-201 Contained in:
[BAC] DKEYP-69C1 (1)
OTHER si:dkeyp-69c1.6-201 TRANSCRIPT PAGES
  • Vega_Trans:OTTDART00000043891 (1)
  • Ensembl_Trans:ENSDART00000065544 (1)
  • PROTEIN PRODUCTSNo links to external site
    ZEBRAFISH SUPPORTING SEQUENCES
    Type Accession # Length (bp/aa) Analysis
    RNA GenBank:BC116479 (1) 1788bp
    GenBank:BC098621 (1) 1779bp
    GenBank:EH553737 (1) 976bp
    GenBank:EE705719 (1) 912bp
    GenBank:CT669949 (1) 768bp
    GenBank:CT669950 (1) 705bp
    GenBank:BM102621 (1) 575bp
    GenBank:EB842247 (1) 274bp
    CITATIONS (2)