header logo image header logo text
Downloads Login
Research
General Information
ZIRC
ZFIN ID: ZDB-TSCRIPT-091110-1025
Transcript Name: si:dkey-277m11.2-002
Previous Name: ch211-249g19.12-001

Add new Alias

Alias
Attribution

Attributions for Alias: {{control.newAlias}}

{{pub.zdbID}}

Delete Alias:

(Including Attributions)
Transcript Type: ncRNA
Annotation Status:
Strain: TU
Non Reference Strains:
Associated with Genes:
SEQUENCE
OTTDART00000043616 (1) [ Show ] (double-click sequence to select) [Download]
Select Analysis Tool
>tpe|OTTDART00000043616|OTTDARG00000018941|ZDB-GENE-060526-285 si:dkey-277m11.2|no_translation DKEY-277M11.2-002 LG_ CR925730.6 Danio rerio protein_coding NOVEL, 439 bp
GACCAGTCATGGCAAACTCTCCTCTGGACTAGACTTGTTT
CTTGTTTTCTAGCAGACGGACGAGGTTATGAGAGCGTGTG
AGTGTGCTGTGGAGAACAGAGTTTGTAGTTGGTGGATGGT
CTGTTTTATGTTTCTTTTTTCAGTGATGAAAAAACATGAA
GATCTGGCATATTTACTGAACTTGGTCTGTGTTTGATGTG
AAGTTGAAAACGCCACAAACGTCAGCTTGAAGAGGCCATC
TGCACGGTTCCCGTCATCTTGCACTCCTCTGAGCGACACG
TAAACAGAAGACCAGAATCGATAACACTTGCACATGACAG
CTGTGTGAACCTGCGGCTGGAACAGACAAGAGCGGAAAAA
TCAAGTCACAGTTTATAGGTTCATTCTGAGTTCAGTGAAA
AAACGACATGTAATATATAAAATGTACAGCATCTATTTT

si:dkey-277m11.2 TRANSCRIPTS
Type Name Length (bp) Analysis
ncRNA si:dkey-277m11.2-002 439
mRNA si:dkey-277m11.2-201 (1) 883
SEGMENT (CLONE AND PROBE) RELATIONSHIPS
si:dkey-277m11.2-002 Contained in:

OTHER si:dkey-277m11.2-002 TRANSCRIPT PAGES
  • Vega_Trans:OTTDART00000043616 (1)
  • PROTEIN PRODUCTS No links to external site
    ZEBRAFISH SUPPORTING SEQUENCES
    Type Accession # Length (bp/aa) Analysis
    RNA GenBank:EH484620 (1) 467 bp
    GenBank:EH495749 (1) 457 bp
    CITATIONS (1)