ZFIN ID: ZDB-TSCRIPT-090929-9930
Transcript Name: aspdh-001
Previous Name: zgc:103722-001

Add new Alias

Alias
Attribution

Attributions for Alias: {{control.newAlias}}

{{pub.zdbID}}

Delete Alias:

(Including Attributions)
Transcript Type: mRNA
Annotation Status:
Strain: TU
Non Reference Strains:
Associated with Genes: aspdh (1)
SEQUENCE
OTTDART00000027369 (1) [ Show ] (double-click sequence to select) [Download]
Select Analysis Tool
>tpe|OTTDART00000027369|OTTDARG00000021494|ZDB-GENE-040912-102 aspdh|OTTDARP00000022419 DKEY-30J10.2-001 LG_ CT573471.12 Danio rerio protein_coding KNOWN, 992 bp
AAGTTCAAACAGCGAAAGCAGAGAGCGACGGGCACCCAGG
GAGAAAGAGACAAAGAAAATAGAGAAAAGATATGGCTGAC
AAAGCCTTAAAGGTTGGAATTGTTGGATACGGACATTTAG
GACAGTTTCTTGTTGAGAAGATCCAGAGTGAAGGCGCTGA
AGTGGGGCTTCAGTTAGCATTCGTGTGGAACCGAAATGCA
GACAAACTGAAAGATTCACTGCCCAAAGATCTCATTCTTC
ATGACCTATCAGATTTCACCCAGAGAGACACTGATGTAAT
TGTGGAGGTTTGTCATCCACTGATAGTAAAAGAATTCGGG
GTCAGATTTCTGTCGCACGCTCACTTCCTGGTGGGCAGCC
CTTCTGCACTGTCTGATGGTCAGCTCGAGCAAGATCTCCG
CACTGCTGCAAAACAACAAGGAAAAACACTCTATGTGCCC
AGCGGTGCATTATGGGGCGGCCAAGATATTCAAAAAATGA
ATGACAGTGGAACTTTACGGGCTCTCTCCATCCGAATGTC
TAAACACCCCTCTTGTTTCCGGCTGACTGGCGGTCTACTC
TCTGATTGGACAGAGGGAGAGGGGAGGCGGGTCTTGTATC
GCGGCTCAGTAGCAGAGCTCTGCCCAATTGCCCCAAACAA
TGTGAACACAATGGCAGCAGCAGCCATAGCAGCATCAAAA
CTGGGCTTCCACGGGGTTACTGGAGAAATCGTTTCAGACA
CTGCATTGGCAGACTACCACATTGTGGAAGTAGACGTTAC
TGGTCCAGATGGATTCTCAGTGAAAACGGTGCGACAAAAC
CCCGCCAAACTGGGAGCTGTAACAGGAAATGCCACATACA
ATTCATTCTGGAGCAGCTTACTGGTCTGCAAGGGTCACGG
AGGGAGAGTATATCTGTGCTGATAACATTGGACTGCTGCA
GAAAGTGCACAAGTTAACAGAGGAAAGCGTTAGTGGATGA
ATGAATTAATAAAACAAGTGTCAAGTCAATAA

GBrowse:
SEGMENT (CLONE AND PROBE) RELATIONSHIPS
aspdh-001 Contained in:
OTHER aspdh-001 TRANSCRIPT PAGES
  • Vega_Trans:OTTDART00000027369 (1)
  • Ensembl_Trans:ENSDART00000055855 (1)
  • PROTEIN PRODUCTSNo links to external site
    ZEBRAFISH SUPPORTING SEQUENCES
    Type Accession # Length (bp/aa) Analysis
    RNA GenBank:BC081519 (1) 1009bp
    CITATIONS (2)