header logo image header logo text
Downloads Login
Research
General Information
ZIRC
ZFIN ID: ZDB-TSCRIPT-090929-9849
Transcript Name: hao2-203
Previous Name: hao2-002

Add new Alias

Alias
Attribution

Attributions for Alias: {{control.newAlias}}

{{pub.zdbID}}

Delete Alias:

(Including Attributions)
Transcript Type: mRNA
Annotation Status:
Strain: TU
Non Reference Strains:
Associated with Genes:
SEQUENCE
OTTDART00000027285 (1) [ Show ] (double-click sequence to select) [Download]
Select Analysis Tool
>tpe|OTTDART00000027285|OTTDARG00000021443|ZDB-GENE-040426-1239 hao2|OTTDARP00000022350 RP71-68N21.6-002 LG_ BX511129.15 Danio rerio protein_coding KNOWN, 773 bp
GTTGTACTGTCCTACCTGAACACATGTGGCAGGAAAAAAC
AGACATCAGAAGCAAATCAAGATATTCAGTGACAAGACGG
TGTCCATTTTTCACATGCAGAGATGGAGCGCCATAAAAGA
ATGAACTTACTGGGCTCTAGCAGAGAAGAAGGCGTCTGTG
CAGAAATGGCTATGGTATGTCTGGATGATTTTGAGGAATA
TGCGAAGCAGCACCTCTCAAAGTCTACATGGGACTATTAC
GAAGCTGGAGCTGATGAATGTTGCACCCGAGACGACAACT
TGCAGGCCTATAAAAGGATTCGCTTGAGGCCACGGATCTT
GCGTGACGTGTCGATCAATGACACTCGGACCTCTGTGCTG
GGACGGGAAATAAGCTTTCCTGTTGGAATTGCACCCACAG
CTTTCCACTGCCTGGCCTGGCATGAGGGAGAACTGGCCAC
TGCCAGAGCTACTGAGGCGTTGAACACATGTTATATAGCC
AGCACTTACGCCACATGTTCAGTGGAGGAGATCGCAGCAG
CAGCACCCAACGGCTACCGCTGGTTCCAGCTGTACTTGTA
CCGCGACCGGAAGCTTTCGGAGCAGATTGTACACAGAGTG
GAGGCTCTTGGCTATAAGGCTCTGGTGCTTACAGTAGACG
TGCCTTACACTGGCAAACGTCGCAATGATATACGCAACCA
GTTCAAGCTACCACCACACCTGAAGGTCAAGAACTTTGAG
GGGATGTTCCAGGAGCAAACAGAAGCCCAGGAGGAATACG
GGATCCCAGCTAA

hao2 TRANSCRIPTS
Type Name Length (bp) Analysis
mRNA hao2-201 (1) 1795
hao2-202 (1) 602
hao2-203 773
SEGMENT (CLONE AND PROBE) RELATIONSHIPS
hao2-203 Contained in:
OTHER hao2-203 TRANSCRIPT PAGES
  • Vega_Trans:OTTDART00000027285 (1)
  • Ensembl_Trans:ENSDART00000136365 (1)
  • PROTEIN PRODUCTSNo links to external site
    ZEBRAFISH SUPPORTING SEQUENCES
    Type Accession # Length (bp/aa) Analysis
    RNA GenBank:DT880634 (1) 804bp
    CITATIONS (2)