header logo image header logo text
Downloads Login
Research
General Information
ZIRC
ZFIN ID: ZDB-TSCRIPT-090929-9743
Transcript Name: myd88-201
Previous Name: myd88-001

Add new Alias

Alias
Attribution

Attributions for Alias: {{control.newAlias}}

{{pub.zdbID}}

Delete Alias:

(Including Attributions)
Transcript Type: mRNA
Annotation Status:
Strain: TU
Non Reference Strains:
Associated with Genes:
SEQUENCE
OTTDART00000027171 (1) [ Show ] (double-click sequence to select) [Download]
Select Analysis Tool
>tpe|OTTDART00000027171|OTTDARG00000021382|ZDB-GENE-040219-3 myd88|OTTDARP00000022262 myd88-001 LG_ BX247944.6 Danio rerio protein_coding KNOWN, 1485 bp
TTCGTCATTTCTCTGACCAGACTAGAGATTTTAGCTAGCA
TTTCCTCAATCTTCGCTTTGCTTGTTGTGTAGTTGTAACG
TGAACTTGCCAACTTGCGTGGTGCACTTCAGTTCGTAAAT
TTGTTTTCTTAAAGTTCAGTATATCCGTAACTTCAGGAAA
TGACAACTTAAAATATATTAACGTTAAACTATTTTACTTT
TTTAATTCACGTTTCTTTTCGGGGTAACGCGGAGATATAC
AACAACTTCGCTGGATAACAGAGGTTTTGCTAATAAATAT
GGCATCAAAGTTAAGTATAGACCATGAGGCGATTCCAGTA
ACAGCTTTAAACTGCAGTTTCCGAAAGAAACTGGGTCTGT
TCCTAAACCCAACAAACACTGTGGCGGCAGACTGGAGGAC
AGTGGCAGAACTGATGGACTTCACGTACCTGGAGATCAAA
AACTTCGAGAAAAGAGAATGTCCCTTTGAAAAGGTCTTGA
CGGACTGGGAAACTCGTCCAGACGCCACAGTAGCGAATTT
ACTGTCGATTTTAGAAAAAGCTGAAAGGAAAGATGTCATA
TCCGAGCTCAAAGAAATTTTAGATGACGACTGCAGGAAGT
ACATGGAAAGACAACAGAGGAAACCGCTTCAGGTTCCAGT
GGTGGACAGTTGTGGACCTCGAACACAGGAGAGAGAAGGA
ATCACGCTTTATGATGATCCACAGGGACTGACACCTGAGA
CCTTTGATGCTTTCATCTGCTACTGTCAGAGTGACATTCA
GTTTGTCCACGAGATGATCAAACAGTTGGAACACACCGAA
TACAACCTGAAGCTTTGTGTGTTTGACAGAGACGTCCTTC
CTGGCACATGCGTGTGGACCATCGCCAGTGAGCTTATCGA
AAAAAGGTGTAAGAGGATGGTGGTGGTCATCTCTGATGAT
TATCTGGATAGTGATGCCTGTGATTTTCAGACTAAGTTTG
CGCTCAGTCTTTGCCCAGGAGCTCGCACTAAACGGCTAAT
CCCTGTCGTCTACAAATCCATGAAGAGGCCGTTTCCCAGC
ATTCTGCGCTTTCTGACCATCTGTGATTACAGCAAACCCT
GCACACAGGTCTGGTTCTGGACTCGACTGGCCAAAGCACT
CTCACTGCCCTAATCTGCTGTGCTGAAGACTCAGCATCAC
ACAAACACACTCTTCTTTACGAAGAGGAAGGACTTGCTAT
TGGGAGAGTTTCAGTATTGAGTCAACATTTTCAAACAGGT
ACTTTTTATAGTGTTCAGGACAGATACATCTGCACAAATC
AAAACATCACTCAGCTTTCCAGAGTAAATAGTTTCTAATC
ATTTGTGATCTTGTTTTACATTTAGTTCTTGTTACACTGG
CTATTTTTGTGTATTATAAAATTTTGATGTTGAATATACT
GTATATTGTGGGAATTATGTGTGCTCTGCTATTTACTGTG
TACATCTGATTATATTGAGAAGGTAAATACAGATTCACAG
ATGAA

GBrowse:
SEGMENT (CLONE AND PROBE) RELATIONSHIPS
myd88-201 Contained in:

OTHER myd88-201 TRANSCRIPT PAGES
  • Vega_Trans:OTTDART00000027171 (1)
  • Ensembl_Trans:ENSDART00000011143 (1)
  • PROTEIN PRODUCTS No links to external site
    ZEBRAFISH SUPPORTING SEQUENCES
    Type Accession # Length (bp/aa) Analysis
    RNA GenBank:BC083419 (1) 1369 bp
    GenBank:DQ100359 (1) 933 bp
    GenBank:AY388401 (1) 855 bp
    GenBank:EE302671 (1) 844 bp
    CITATIONS (2)