header logo image header logo text
Downloads Login
Research
General Information
ZIRC
ZFIN ID: ZDB-TSCRIPT-090929-9701
Transcript Name: lnx2a-202
Previous Names: lnx2-001, lnx2a-001

Add new Alias

Alias
Attribution

Attributions for Alias: {{control.newAlias}}

{{pub.zdbID}}

Delete Alias:

(Including Attributions)
Transcript Type: mRNA
Annotation Status:
Strain: TU
Non Reference Strains:
Associated with Genes:
SEQUENCE
OTTDART00000027121 (1) [ Show ] (double-click sequence to select) [Download]
Select Analysis Tool
>tpe|OTTDART00000027121|OTTDARG00000021353|ZDB-GENE-060228-2 lnx2a|OTTDARP00000022226 lnx2-001 LG_ BX571696.7 Danio rerio protein_coding KNOWN, 2726 bp
CGGCTCGGGGAAGCTGCGGTGGATGTGATTGAGCTCCATG
ATTCTCCCCTCTCGGGGCCAGAGTTCACAGCATCCGAGAA
GAACGCGAATAGAGTGATGTCACTGTGCCTGCCAGGGGGT
GGTCGTCCCCTGCCGGAGTCGCACAGCCTCTGACGCCCGC
GGGATGGACTGAGTGAGTGTAGCCAAAGCCGAGAGCAATG
GGCAGTCTGGGAGAGGGAGTGGACCCGGGCATGGTGAGCG
AAGCTCTTCTGGAGGCCCTTTGCTCTGAATGTGGACAGAT
TCACCGCACCTGGGAGAACCACCTTTATAACTATCGTTTG
GAAGTGGATGATGATTTGGTGTGCCACATCTGCCTTCAGC
CGTTAGTTCAGCCCCTGGATACACCATGTGGCCACACCTT
CTGTGCCCGCTGTCTGCGCAGCTTCCTGCAGGAACGGGAC
TTCTGTCCACTGGACCGTGCGCATCTGCAGCTGCAGGTCT
GCCGGCGCTCCAGCATTCTGGTGCACAAGCTGCTGGACAA
GTTGTCGGTCACCTGTCCGCTCACGCCCTCCTGCTCGCTC
AGCATGCCTCGCTGCGACCTGGAGGCACATCTCAAACACA
GGTGTCCTGGAACACAGAGTCAGCGAACAAAGCTAGAGCG
GACGCAGATGGAGGGAAGTGAGGACAGGGTCACAGCGACC
AATCCCCCCAAATCCCCCCAGACTGAGATAAAGGAAGACA
CGCCATCACCACCTGCTGGATCCAATGCATGCAACAATGT
TCCTACATGGACAGAAGAGCCTGGTATAGACAACCCTGCC
TTTGAAGAAAGCACAGAAGAAGACAGATGGGACTTTGTTG
AAACTCTTCCTCTTTCTGCTGAAGAAGGTTGTGTAAAACT
TCCTTCTCTACCTGAGGGAGAAATCACTACTATTGAGGTT
CACCGTACAAACCCCTACTCGGAGATGGGCATAAGTATTG
TGGGTGGAAATGAGACTCCCCTGATAAATGTGGTAATACA
GGAGGTGTACCGTGACGGTGTTATAGCCCGAGACGGAAGG
CTGCTGGCCGGAGACCAAATACTTCAGGTGAACAATGTAG
ACATCAGTAACGTGCCCCATAACTTTGCTCGCTCTACACT
GGCCCGTCCCTGTGCTACCCTTCAGCTGACGGTTTTAAGA
GAGCGCCGCTGCTCTGCCAGGCCACCTGCAGCAACTGCAT
CACCCAAGGGCAGCCCTGCCAGCATACGCATCACCCTGCA
CAAGAGGGAATCATCAGAGCAGCTGGGCATCAAGCTTGTG
CGGCGTACAGATGAAGCCGGCGTTTTTATTCTGGATCTGC
TGGAGGGAGGCTTAGCTGCGAAAGATGGGCGACTCTGCAG
CAACGACAGGGTGCTGGCTGTCAATGAGCATGACCTGAGA
CATGGCACGCCAGAGCTGGCAGCTCAGATTATACAGGCTA
GCGGAGAAAGAGTCAATCTGCTGATTAGCCGGTCCAGCAA
GCAGACTATGGCGGTGCACACAGGCTCCACCTTGACCAGG
GACATTTGGAGCCATGATCACATCCCGCCACTTCCCAGTA
CTGCGACCCCAAGTCCCGTCCCCAGTCTGCACCTTGCCAG
GTCTTCCACCCAGAGAGATCTCTCCCAGTGTGTGAACTGT
AAAGAGAAACACATCACTGTGAAGAAGGAGCCTCATGAGT
CTCTGGGAATGACTGTGGCAGGAGGACGGGGCAGCAAAAG
TGGGGAACTGCCCATATTTGTGACGAGCGTCCAGCCCCAT
GGCTGCCTGTCACGTGACGGACGAATCAAACGTGGGGATG
TACTGTTAAGTATTAACGGTCAGGATTTGACCTACCTGAG
CCACAGCGAAGCAGTTGGCACCCTGAAGTCCAGCGCCACG
TCCTGCTCTGTTCAGCTGAAAGCACTAGAAGTCACCATGG
TGGAAGAGCCAGGCCTGGACGAAGAGCTTCTCCCTCCACA
CGAAAATGACTACGATGCAAGCTGGTCGCCATCATGGGTC
TTGTGGCTTGGGCTTCCCAGCTACCTGCATAGCAGTCATG
AGATCGTCCTCCGCAGGAGTCACCCTGGCAGCTGGGGCTT
CAGCATTGTTGGAGGTTATGAGGAGAACCACAGCAACCAG
GCATTCTTTATCAAGACTATCGTCCTTGGAACTCCCGCAT
ACTACGATGGTCGTCTAAAGTGTGGTGACATGATAGTTGC
TGTAAACGGTCTGTCCACAGCTGGCATGAGTCATTCCGCG
CTTGTGCCCATGCTTAAGGAGCAGCGGAGCAGGGTGGCGC
TTACGGTTGTGTCCTGGCCAGGAAGTCTGATCTAACTCAA
CCAGGACACCATGCCACACCCCAGACAACACTCATATCTG
TGTCTTCTAATGGTCCTATGTGTTCTACTCTCTGCCACGG
AGGCACCATACTGTCAAAGCCAGAGTCTCGAAAAAAAAAC
AACAACAACGAATGCTTTTACTTGATGCTGAACAAACCAG
GCCTTAGAAAACCTGCCACGCCCATGAGGCTTTTCCCCCT
CTGGAGAGCAGCCTTAAGGTCTCCCCTCACCATGCCGATC
AGCAGTCCACTCTACCGGAGGTTTTATATTCATGTTATCT
CTAAATGTGATCTACGTTTGTGAATGTTTGTGAAAAAGAG
AGACAGAACAAACAGTGTATGTATGCGTGCAAGTATGAAT
GGATGAATGTGCACAGCTGTTTAATAAATCTTTCCCAGTG
AGGACA

GBrowse:
SEGMENT (CLONE AND PROBE) RELATIONSHIPS
lnx2a-202 Contained in:

Genome Resources: Vega_Trans:OTTDART00000027121 (1),  Ensembl_Trans:ENSDART00000123216 (1)
PROTEIN PRODUCTS No links to external site
ZEBRAFISH SUPPORTING SEQUENCES
Type Accession # Length (bp/aa) Analysis
RNA GenBank:BC091554 (1) 1320 bp
GenBank:EB957408 (1) 614 bp
GenBank:BG737568 (1) 590 bp
CITATIONS (2)