header logo image header logo text
Downloads Login
Research
General Information
ZIRC
ZFIN ID: ZDB-TSCRIPT-090929-9700
Transcript Name: arxa-201
Previous Names: arx-001, arxa-001

Add new Alias

Alias
Attribution

Attributions for Alias: {{control.newAlias}}

{{pub.zdbID}}

Delete Alias:

(Including Attributions)
Transcript Type: mRNA
Annotation Status:
Strain: TU
Non Reference Strains:
Associated with Genes:
SEQUENCE
OTTDART00000027120 (1) [ Show ] (double-click sequence to select) [Download]
Select Analysis Tool
>tpe|OTTDART00000027120|OTTDARG00000021352|ZDB-GENE-990415-15 arxa|OTTDARP00000022225 arx-001 LG_ BX470095.12 Danio rerio protein_coding KNOWN, 1522 bp
GCATATGGCATTAGCGGCCAGGGTGGGATAGGCAAGAGAG
ACGTTTCAGATACAGTGCGAGAGAGAGTAACAGTCACCCA
CTCGAGCACGACTGAGGACGATACAAACATGAGCAGTCAG
TACGACGACGATAGCCGCGATCGGAGCGAATGTAAAAGCA
AGTCGCCCACCGTGCTTTCTTCCTACTGCATAGACAGTAT
ACTGGGCAGAAGAAGCCCCTGTAAAGTCAGACAACTGGGA
GCGCAAAGTTTACCAGCACCCGTCAGACCGGACCACGAAA
TGACAACCGAAGTCACCTCCAAAGAGAATTCGTTTGACTC
GGACATGCACCTGCCGCCCAAATTGCGCCGGCTCTACGGC
CCTGGTGGGAAGTACCTGGACTCCGGGAGGGGGTTTCACG
AGCACCTAGAAAAGGGTGAGAGGGAGAGACTGCTGGACCA
AGCCTGCGAGAGTCTCAAAATCAGCCAAGCGCCTCAAGTC
AGCATCAGCCGTAGCAAGTCGTACAGAGAAAACGCGCCGT
TCAGCCAGAGTGATGAAGGCCAGAGTCCCGAACACATGGC
GCAGGAGCTGGTGGAGCTCAGCACCCTGAAGTTTGAAGAG
GATGTAGTCAAAGAGGAGGCGTGCGGAGACAACAGTCTGT
CTCCCAAGGATGAAGAGAGCTTACACAACGATGGGGATGT
AAAAGATGGAGAGGACAGTGTGTGTCTGTCGGCCGGCAGC
GACTCGGAGGAAGGGATGCTTAAACGGAAGCAGAGAAGAT
ACAGGACTACCTTCACCAGCTATCAGCTGGAGGAGCTGGA
GAGGGCCTTCCAGAAAACACACTACCCCGATGTGTTCACC
AGAGAGGAGCTCGCGATGAGGCTGGATCTGACAGAAGCGC
GCGTTCAAGTTTGGTTTCAGAACCGAAGGGCAAAGTGGAG
GAAACGTGAAAAGGCAGGTGTTCAGGCTCACCCCACAGGC
CTGCCTTTTCCTGGGCCGCTGGCAGCTGCTCACCCCTTGA
GTCATTACCTGGAAGGAGGACCCTTCCCACCTCACCCTCA
CCCAGCTCTGGAGTCAGCATGGACCGCTGCAGCAGCAGCT
GCTGCTGCGTTTCCAGGCCTGGCCCCACCCCCAAATAGCT
CCGCCCTCCCTCCTGCCACACCCCTTGGCCTTGGAACCTT
CCTGGGCACAGCAATGTTCAGGCATCCAGCCTTCATTGGA
CCCACTTTTGGCAGACTCTTCTCAAGTATGGGTCCTCTGA
CCAGTGCTTCCACAGCGGCCGCTCTCTTGCGCCAAACTGC
ACCACCAGTGGAGAGTCCAGTGCAGCCATCAGCAGCCCTC
CCAGAACCACCTTCTTCCTCATCCTCTACAGCCGCCGACC
GCAGGGCATCCAGCATTGCAGCTCTGCGTCTCAAAGCAAA
GGAACATTCGGCCCAATTGACCCAACTCAACATCCTGCCG
TCCGGCACTGCAGGGAAAGAAGTGTGCTGATCCTTCTCCT
TAAAAACAAAACAAATGATTAAAGAAACCATCTCAACAAA
AA

GBrowse:
SEGMENT (CLONE AND PROBE) RELATIONSHIPS
arxa-201 Contained in:
[BAC] DKEY-162H1 (1) (order this)

OTHER arxa-201 TRANSCRIPT PAGES
  • Vega_Trans:OTTDART00000027120 (1)
  • Ensembl_Trans:ENSDART00000080810 (1)
  • PROTEIN PRODUCTS No links to external site
    ZEBRAFISH SUPPORTING SEQUENCES
    Type Accession # Length (bp/aa) Analysis
    RNA GenBank:AB006104 (1) 1414 bp
    GenBank:BI475505 (1) 637 bp
    GenBank:BM185851 (1) 620 bp
    GenBank:BI475230 (1) 582 bp
    GenBank:EB853090 (1) 456 bp
    CITATIONS (2)