header logo image header logo text
Downloads Login
Research
General Information
ZIRC
ZFIN ID: ZDB-TSCRIPT-090929-9536
Transcript Name: ada2a-201
Previous Name: cecr1a-001

Add new Alias

Alias
Attribution

Attributions for Alias: {{control.newAlias}}

{{pub.zdbID}}

Delete Alias:

(Including Attributions)
Transcript Type: mRNA
Annotation Status:
Strain: TU
Non Reference Strains:
Associated with Genes:
SEQUENCE
OTTDART00000026945 (1) [ Show ] (double-click sequence to select) [Download]
Select Analysis Tool
>tpe|OTTDART00000026945|OTTDARG00000021250|ZDB-GENE-030902-4 cecr1a|OTTDARP00000022085 cecr1-001 LG_ BX004976.7 Danio rerio protein_coding KNOWN, 2484 bp
GTTGTTGTGGAAGTCAGTTGCAGGGTAGATGTCGACCGAG
CTCTGTTAAATACAATTACTATTAAACTTCTGTTGTAGCG
ATTCTGTGTACTCAACAGAGATCTGTGGTTGAATTACCTT
ACAGACATGCATGTGTTGTTCCTTGGAGATCTGATGTGGA
TCTACTTGCTGCTTCTGTGTTGTGCATCATGTAACGGTAG
ACCAGATCCCAGGAAACGGGACGCTCTCATAGGCCTGGAG
GCATCTAGACGGACAGGAGGTGACATTACGCTGAACCAGA
GAGAAAAACTGCTTGATGGAAAACTTCAGAAATTGAAGCA
GCATGATATGGAGGCAGGACAGTTTCCACCGTCCATGCAT
TTCTTCAAGGCAAAGCGCCTCATTGACCAAAGTCCTGTCT
TTAATTTGATACAGAAGATGCCTAAAGGTGCTGCACTGCA
CGTACACGACTTTGCTATGGTTTCAGTGGATTGGCTGGTG
AAGAACGTGACCTACAGAGAGAACTGCTATGTTTGCTTCA
CAGACAAGCAGACCGTGCAGTTCATCTTTTCCACTGGACC
ACCAGCATCCAGTTTACACTGCTCCTCATGGACTCTGCTC
AGATCCCTCAGGGAAAAAATTAAAAACACCACTGAACTGG
ACAACAGTTTTATTCGAAATCTCACGCTCTTTACTGAAGA
CCCAGATAGAGCTTATCCTAATCAGGATACTGTGTGGGAG
AGGTTCGAGCAGGTATTTTTAGTGGCCTATGGGTTGGTCA
CTTATGCCCCTGTCTTTAAAGACTACCTCTATGAAGGTCT
CCGACAGTTTTATGAGGACAACATCATGTATGTGGAGATC
AGAGCACTGCTGCCACAGACATATGAACTCGATGGCAGAC
TGAATGATAAAGACTGGAGTATGGCTGCCTGTCAGGAAGT
TGTGAACCAATTTAAAAAACACCATCCAGACTTCATCGGG
GCTCGGGTGATTTTCACTGTCCACAGAAAAATAAATGCAA
CTGAGGCGGTGAAGACAGTAGAGGAAGCAATGATACTGAG
AAGAAACTTTCCAGATGTCATGGCAGGTTTTGACTTTGTA
GGACAGGAAGACCTTGGAAGACCTTTGTGGTACTTCAAGG
ACGCTTTGAGTTTACCTGAAGACAAGGGTTTTAACCTGCC
CTACTTCTTTCACGCTGGAGAGACAGATTCACAGGGAACA
GATGTGGATCAAAACCTCATGGATGCTCTTCTGTTCAACA
CCACACGTATCGGGCACGGCTTTGCTTTGGCACGTCACCC
TGTGGTTAAAGAGATGGCCAGAAAGATGGACGTGCCGATT
GAAGTCTGCCCTATTTCAAATCAGGTGTTGAAGCTGGTCT
CAGACCTGCGGGATCATCCGGCTGCAGTGCTGATGGCTGA
AGGTCATCCTCTGGTGATCAGCTCTGATGATCCTGCTGTT
TTTGGAGCCACGGCTCTTTCACACGATTTTTATGAAGCTT
TTATGGGTTTTGGAGGAATGAGCTTTAATTTAGGCACATT
GAAAGAGCTAGCTTTAAACTCCCTCAGGTACAGCACATTG
CCAAGTCAAAGAAAGGAGGAAGCTATCGACGCTCTGCTAG
TAAAATGGGACAAGTTTGTTTGGGAAAGTTTACTTTGACA
GGACGTTACCACATCAGGACGTTTTTAATTAGGAGGCCAT
TGTTTACAAGACATCTACGTCATTTGTTTGTCGTATTGGT
GATACTGAGGTGCGAAAACGCCAATTTATGCTGAGAGAAA
CAGAATGTAATGCCTTGAACTGATCTGTGCTGCCATCTTG
TGGAGAATCTGAAGCAGTGCTTTTGTGAATATTAATCGTG
GTTTCAGATTTATATAAATGTAAAGTCACACAATCTGAAC
GGGGTTAACTACTTAACTACTCAGGATGCGTGATAAACCT
TGTCTTGTTGTAAGTGTGCATTAAAGGGAATGTTCACGCA
ACAATGGTAAATTCAGTCATCAACTTGCTTGAGTTTCTTC
CGTTGAACACAAAGAAGTTTTTAGGCATTCTGCAAAGTAC
CATTTTTGTTTTCAACAGAAGAAAGGAACTCCTGAAGGTC
TGTAACTATTTAAAGAGGAAATAGTGAGTATTTTTGGTGT
GAACCGTCTTTTTAAAGCTCATCTGAAAAGAGGTTTCACG
GTTATTATAATATAACTCCATCTTTGGAGAACATTTTTTA
CCAAACCTGAGAGAGTTGTCCTCAAATTAAAGACTATTTA
CCTGAAAAACCATTCAGAAAAGTTTATAATGATATTTGGA
AGTGTTCATTACAGCTTTTTATAAACACTGATCAGTAATC
TTCCTTACAACATTCAAATTATTAACTAACCCCTAACCAA
CATTTTTAACTGCGTAAACCCTGACAAGCTGACTTGTTAT
CTGATTGCGGTTTGTGAATACAAAACTCATATGGTTTAAA
ATATGAAAGTATTAATATTAATAAAAAAAAAAGTATTGCA
AAAA

GBrowse:
SEGMENT (CLONE AND PROBE) RELATIONSHIPS
ada2a-201 Contained in:

Genome Resources: Vega_Trans:OTTDART00000026945 (1),  Ensembl_Trans:ENSDART00000073416 (1)
PROTEIN PRODUCTS No links to external site
ZEBRAFISH SUPPORTING SEQUENCES
Type Accession # Length (bp/aa) Analysis
RNA GenBank:AF384217 (1) 2505 bp
GenBank:BC045839 (1) 1954 bp
GenBank:DV594967 (1) 797 bp
CITATIONS (2)