header logo image header logo text
Downloads Login
Research
General Information
ZIRC
ZFIN ID: ZDB-TSCRIPT-090929-9532
Transcript Name: gria2b-004
Previous Name:

Add new Alias

Alias
Attribution

Attributions for Alias: {{control.newAlias}}

{{pub.zdbID}}

Delete Alias:

(Including Attributions)
Transcript Type: ncRNA
Annotation Status: retained intron
Strain: TU
Non Reference Strains:
Associated with Genes:
SEQUENCE
OTTDART00000026941 (1) [ Show ] (double-click sequence to select) [Download]
Select Analysis Tool
>tpe|OTTDART00000026941|OTTDARG00000021247|ZDB-GENE-020125-4 gria2b|no_translation gria2b-004 LG_none CR456621.10,CT009687.10 Danio rerio protein_coding KNOWN, 535 bp
ATATTCTGTTATTTCTACATTTGAATGTTTAATACTGAGA
TGGTGTGCTTTCCCCGAGCGCTGACCCGTGTCTCGTGTGC
ATTTTCAGGAGAAGACCAGCGCGCTCAGCCTGAGCAATGT
GGCTGGCGTCTTCTACATCCTTGTGGGCGGCCTGGGCTTG
GCCATGCTGGTGGCCCTGGTCGAGTTCTGTTACAAGTCCC
GAGCCGAGGCCAAGCGCATGAAGGTGACCTTTTCGGATGC
TATGAGGAGCAAAGCGAGACTGTCTGTTACTGGGAGTACT
GGCGAGAACGGACGTGTGATGAGTCCTGAATTCCCCAAAG
CCGTACATGCAGTGCCCTTTGTTAGACCTGGTGTGGGAAT
GAACGTCAGTCTGACTGATCTCTCCTGATGGATAAGAACC
TGCCGAGTGCCTTACACAATGGTTTTCAATAGAGCGCGTT
CTATTCTCTTTCCTGTCGCTCTCTCCCTTATCATCACTCG
TCTGAATGGAGGATGGAGGCCTCATTTGATGTCATACAGA
CATAATCCTTCCTTG

gria2b TRANSCRIPTS
Type Name Length (bp) Analysis
ncRNA gria2b-003 (1) 671
gria2b-004 535
mRNA gria2b-201 (1) 4505
gria2b-202 (1) 3011
gria2b-205 (1) 2724
gria2b-206 (1) 446
SEGMENT (CLONE AND PROBE) RELATIONSHIPS
gria2b-004 Contained in:
OTHER gria2b-004 TRANSCRIPT PAGES
  • Vega_Trans:OTTDART00000026941 (1)
  • PROTEIN PRODUCTSNo links to external site
    ZEBRAFISH SUPPORTING SEQUENCES
    Type Accession # Length (bp/aa) Analysis
    RNA GenBank:EB943287 (1) 535bp
    CITATIONS (1)