ZFIN ID: ZDB-TSCRIPT-090929-9530
Transcript Name: gria2b-202
Previous Name: gria2b-002

Add new Alias

Alias
Attribution

Attributions for Alias: {{control.newAlias}}

{{pub.zdbID}}

Delete Alias:

(Including Attributions)
Transcript Type: mRNA
Annotation Status:
Strain: TU
Non Reference Strains:
Associated with Genes:
SEQUENCE
OTTDART00000026939 (1) [ Show ] (double-click sequence to select) [Download]
Select Analysis Tool
>tpe|OTTDART00000026939|OTTDARG00000021247|ZDB-GENE-020125-4 gria2b|OTTDARP00000022082 gria2b-002 LG_none CR456621.10,CT009687.10 Danio rerio protein_coding KNOWN, 3011 bp
TGCAGACCGCAGCCGCTCTCATTCTCAGCAACGCCTCAAT
ATGTTACGGATTTGACTCATACTGTAAACGACAGATTATT
TCCTTCACACAGTGGCTGAACACACACTGTCGAGGAGATG
CAACAGTTGAAGAATTTATCGATTTGTCTCATAGCCCTCT
TATTAGGGATGACAACTGGAGGCTCTCCAAGTGTTCAAAT
CGGAGGCTTGTTTCCGAGGGGAGCCGATCAGGAGTACAGC
GCGTTTCGGATCGGAATGGTTCAGTTCGGAACGGCTGAAT
TTAGACTGACGCCTCACATCGATAATCTGGAAGTAGCAAA
CAGTTTCGCTGTAACTAACTGCTTCTGTTCTCAGTTCTCA
AGGGGAGTTTATGCTATCTTTGGATTTTACGACAAGAAGT
CAGTGAACACAATAACGTCGTTCTGTGGGACACTTCACGT
CTCCTTCATCACGCCCAGCTTTCCCCTGGATGGAAATCAG
CAGTTTATTATTCAGATGCGACCAGACATCAAAGGGCCTC
TCCTGAGTCTCATCGAGTACTACAAATGGGACAAGTTTGC
CTACCTGTATGACAGTGACCGAGGACTTACCACACTCCAA
GTTGTGCTGGACACAGCAGCAGAGAAGAAATGGCAGGTGA
CCGCCATCAACGTGGGCAACATGAAGGATGAGAGAAAGGA
TGAAGCATATCGCTCACTCTTTCAAGACCTGGAAAACAAG
AAGGAGCGGAGGGTCATTCTAGATTGTGAGCAGGACAAAG
TTAAAGACATCATGGAACAGGTCATTACTATTGGCAGGCA
TGTGAAGGGATATCACTACATCATAGCAAACCTGGGTTTT
GTGGATGGAGATCTTTCTAAAATCCAGTATGGTGGAGCGA
ATGTGTCAGGCTTTCAGATTGTGGATTTTGATGACCCTCT
GGTGTCCAAATTTGACCAGCGCTGGGAAGCTCTGGAGGAA
AAAGAATATCCTGGAGCAGACAGCAAGATACGGTACACTT
CAGCACTGACGTATGACGCAGTTCAGGTGATGACTGAGGC
TTTCCGTTACCTGCACAAACAGAGAATTGACATCTCTCGT
AGAGCGAACAATGGAGACTGCCTGGCCAATCCTGCTGTTC
CATGGGCGCAAGGGGTGGAGATAGAACGTGCCCTAAAACA
GGTGAGAGTTGATGGTCTCACTGGTAACATTCAGTTTGAC
CAGTATGGAAAGAGAGTGAATTACACCGTCAATGTCATGG
AATTGAAAAGCAACGGAGCAGTTAAGATTGGCTATTGGAA
CGAAGTGGATAAAATGGTCGTCACAAAATCAGATCTCTTC
CCAAATGACACAATGGGGCTTGAAAACAAGACTGTGATCG
TCACCACCATTCTAGAAGCCCCATATGTAATGTTAAAGAA
GAATGCTGACCTTTTTATGGATAATGAAAGATATGAGGGG
TATTGTGTGGACCTGGCAGCTGAAATAGCAAAGCACTGTG
GATTTAAATATCAGCTGAAAATAGTAGGCGATGGCAAATA
TGGAGCTAGAGATGCAGAGACGAAGATCTGGAATGGAATG
GTTGGAGAATTGGTTTATGGGAAAGCTGACATCGCAGTGG
CTCCACTGACTATCACTTTAGTCCGAGAAGAAGTTATCGA
CTTCTCAAAGCCGTTCATGAGTTTGGGCATCTCCATCATG
ATCAAGAAGCCTCAGAAGTCCAAGCCTGGTGTTTTCTCAT
TCCTGGATCCACTGGCTTATGAGATCTGGATGTGTATTGT
GTTCGCTTACATCGGTGTAAGTGTGGTGCTTTTCCTGGTC
AGTCGTTTCAGTCCATATGAGTGGCACACAGAGGAATATG
AGGATGGACAGATCCAGACCAACGAGTCGACCAATGAGTT
TGGGATCTTCAACAGTCTTTGGTTCTCTCTTGGAGCTTTT
ATGAGACAAGGATGTGATATTTCACCCAGGTCTCTTTCTG
GCCGCATAGTTGGAGGAGTCTGGTGGTTTTTCACCCTGAT
CATCATTTCTTCCTACACGGCTAACTTGGCTGCCTTCCTA
ACAGTGGAGAGGATGGTGTCTCCAATTGAGAGTGCTGAGG
ACTTGGCAAAGCAAACAGAGATTGCTTATGGAACATTAGA
TTCTGGTTCAACAAAAGAGTTTTTCAGACGTTCTAAAATT
GCACTTTTCGACAAGATGTGGACTTACATGAAAGGTGCAG
AGCCCTCTGTATTTGTTAAGACGACGGCAGAAGGTGTCAT
GCGAGTGAGGAAGTCCAAGGGGAAGTATGCATACCTACTG
GAGTCCACCATGAACGAGTATATCGAGCAGCGCAAACCCT
GCGACACTATGAAGGTCGGAGGGAACCTGGACTCCAAAGG
CTACGGCATCGCCACCCCCAAAGGATCCTCATTAAGAAAT
GCGGTTAACCTCGCAGTACTAAAACTGAATGAACAAGGCC
TGTTGGACAAATTGAAAAACAAATGGTGGTACGACAAGGG
AGAGTGCGGCAGCGGGGGAGGTGATTCCAAGGAGAAGACC
AGCGCGCTCAGCCTGAGCAATGTGGCTGGCGTCTTCTACA
TCCTTGTGGGCGGCCTGGGCTTGGCCATGCTGGTGGCCCT
GGTCGAGTTCTGTTACAAGTCCCGAGCCGAGGCCAAGCGC
ATGAAGGTGACCTTTTCGGATGCTATGAGGAGCAAAGCGA
GACTGTCTGTTACTGGGAGTACTGGCGAGAACGGACGTGT
GATGAGTCCTGAATTCCCCAAAGCCGTACATGCAGTGCCC
TTTGTTAGACCTGGTGTGGGAATGAACGTCAGTCTGACTG
ATCTCTCCTGATGGATAAGAACCTGCCGAGTGCCTTACAC
AATGGTTTTCAATAGAGCGCGTTCTATTCTCTTTCCTGTC
GCTCTCTCCCTTATCATCACTCGTCTGAATGGAGGATGGA
GGCCTCATTTGATGTCATACAGACATAATCCTTCCTTGGC
CCTTTATAACAAAAGATGCACTCTCTAGTATCGGAAAAGA
CACTCGCTTAC

gria2b TRANSCRIPTS
Type Name Length (bp) Analysis
ncRNA gria2b-003 (1) 671
gria2b-004 (1) 535
mRNA gria2b-201 (1) 4505
gria2b-202 3011
gria2b-205 (1) 2724
gria2b-206 (1) 446
SEGMENT (CLONE AND PROBE) RELATIONSHIPS
gria2b-202 Contained in:
OTHER gria2b-202 TRANSCRIPT PAGES
  • Vega_Trans:OTTDART00000026939 (1)
  • Ensembl_Trans:ENSDART00000074671 (1)
  • PROTEIN PRODUCTSNo links to external site
    ZEBRAFISH SUPPORTING SEQUENCES
    Type Accession # Length (bp/aa) Analysis
    RNA GenBank:AF361751 (1) 3031bp
    GenBank:EB943857 (1) 501bp
    GenBank:AW281144 (1) 450bp
    CITATIONS (2)