header logo image header logo text
Downloads Login
Research
General Information
ZIRC
ZFIN ID: ZDB-TSCRIPT-090929-9516
Transcript Name: krt18-003
Previous Name:

Add new Alias

Alias
Attribution

Attributions for Alias: {{control.newAlias}}

{{pub.zdbID}}

Delete Alias:

(Including Attributions)
Transcript Type: ncRNA
Annotation Status:
Strain: TU
Non Reference Strains:
Associated with Genes:
SEQUENCE
OTTDART00000026925 (1) [ Show ] (double-click sequence to select) [Download]
Select Analysis Tool
>tpe|OTTDART00000026925|OTTDARG00000021240|ZDB-GENE-030411-6 krt18|no_translation krt18-003 LG_ CR450756.4 Danio rerio protein_coding KNOWN, 757 bp
CTGAGCTCTACCTCTCTCCAGGCCTTCATTCACTCGTCTG
CTCACTTACACCAGCGACCATGAGTCTGAGAACAAGCTAC
AGCGTGCGTTCCTCCACCTCCCAGGTGCCAGTGTCCCAGG
TGTCTATCAAGCGCACCACCAATGTGCCGACTTACAGGGC
TGCGAGCATCTATGGCGGCGCTGGAGGCCAAGGAACCCGC
ATCTCCTCTGCCTCCTACTCAGGAGTCCGCAGTGGACTGG
GAGTTCCCTCGATGTCCAGCTCCATCCAAGTGAGTGCAAG
TGGTAGCACAGGCGAGATCATGGGCAATGAGAAGATGGCC
ATGCAGAACCTGAACGACCGTCTGGCCTCCTATCTGGAGA
AAGTGAGGATCCTGGAGCAGGCCAACAGCAAGCTGGAGCT
GAAGATCCGGGAGGCCCTAGAGAAGAGAGGTCCTGATGTC
CACGACTACAGCCGCTTCCAGCCAATCGTTGATGAGCTGC
GCAAGAAGATCTTTGATGCCACCACAAACAATGCTCGTCT
AGTGCTCCAGATTGACAACGCCCGCCTGGCAGCTGATGAC
TTCAGAGTCAAGTATGAATCTGAGCTGTCCATCCGCCAAG
GTGTGGAGGCCGACATCACCGGCCTAAGAAAGGTCATCGA
TGACACCAACCTGAACCGCATGAACCTTGAGAGCGAGATC
GAGGCCCTCAAAGAAGAGCTCATCTTCCTTAAGAAGAACC
ATGACAATGTGAGTACACATCTGGCACATCTGGAAAC

krt18a.1 TRANSCRIPTS
Type Name Length (bp) Analysis
ncRNA krt18-002 (1) 596
krt18-003 757
mRNA krt18-201 (1) 1749
SEGMENT (CLONE AND PROBE) RELATIONSHIPS
krt18-003 Contained in:

OTHER krt18-003 TRANSCRIPT PAGES
  • Vega_Trans:OTTDART00000026925 (1)
  • PROTEIN PRODUCTS No links to external site
    ZEBRAFISH SUPPORTING SEQUENCES
    Type Accession # Length (bp/aa) Analysis
    RNA GenBank:CT715162 (1) 757 bp
    CITATIONS (1)