header logo image header logo text
Downloads Login
Research
General Information
ZIRC
ZFIN ID: ZDB-TSCRIPT-090929-9514
Transcript Name: krt18-201
Previous Name: krt18-001

Add new Alias

Alias
Attribution

Attributions for Alias: {{control.newAlias}}

{{pub.zdbID}}

Delete Alias:

(Including Attributions)
Transcript Type: mRNA
Annotation Status:
Strain: TU
Non Reference Strains:
Associated with Genes:
SEQUENCE
OTTDART00000026923 (1) [ Show ] (double-click sequence to select) [Download]
Select Analysis Tool
>tpe|OTTDART00000026923|OTTDARG00000021240|ZDB-GENE-030411-6 krt18|OTTDARP00000022071 krt18-001 LG_ CR450756.4 Danio rerio protein_coding KNOWN, 1749 bp
GTCCTGTGCTCTGCTCTGCTGTGTTACTGAGCTCTACCTC
TCTCCAGGCCTTCATTCACTCGTCTGCTCACTTACACCAG
CGACCATGAGTCTGAGAACAAGCTACAGCGTGCGTTCCTC
CACCTCCCAGGTGCCAGTGTCCCAGGTGTCTATCAAGCGC
ACCACCAATGTGCCGACTTACAGGGCTGCGAGCATCTATG
GCGGCGCTGGAGGCCAAGGAACCCGCATCTCCTCTGCCTC
CTACTCAGGAGTCCGCAGTGGACTGGGAGTTCCCTCGATG
TCCAGCTCCATCCAAGTGAGTGCAAGTGGTAGCACAGGCG
AGATCATGGGCAATGAGAAGATGGCCATGCAGAACCTGAA
CGACCGTCTGGCCTCCTATCTGGAGAAAGTGAGGATCCTG
GAGCAGGCCAACAGCAAGCTGGAGCTGAAGATCCGGGAGG
CCCTAGAGAAGAGAGGTCCTGATGTCCACGACTACAGCCG
CTTCCAGCCAATCGTTGATGAGCTGCGCAAGAAGATCTTT
GATGCCACCACAAACAATGCTCGTCTAGTGCTCCAGATTG
ACAACGCCCGCCTGGCAGCTGATGACTTCAGAGTCAAGTA
TGAATCTGAGCTGTCCATCCGCCAAGGTGTGGAGGCCGAC
ATCACCGGCCTAAGAAAGGTCATCGATGACACCAACCTGA
ACCGCATGAACCTTGAGAGCGAGATCGAGGCCCTCAAAGA
AGAGCTCATCTTCCTTAAGAAGAACCATGACAATGAGGTA
ATGGAGCTTCGTAACCAAATCTCCCAGTCAGGAGTGCAGG
TGGATGTTGATGCTCCTAAGGGACAAGACCTTTCCCAGAT
CATGGAGGAGATCAGAGCCAAGTACGAGAAGATGGCCCTG
AAGAACCAGGAGGAGCTGAAGGCCTGGCATGAATCTCAGA
TCACAGAGGTTCAGGTACAAGTCACGCAGAACACAGAGGC
CCTCCAGGGTGCCCGTTCAGAGGTTAACGAACTTCGCAGA
CAAATTCAGACATTGGAGATCGAGCTGGAATCACAGAAGA
ACCTGAAAGGGTCACTGGAGGGAACTCTGCGGGACACAGA
AATGCGATACAACATGGAGATCGAGAATCTCAACACTATC
ATTCTGCAGCTGGAGGCTGAGCTCACACAACTGCGCGGTA
ACATCCAGCATCAGACGCAGGAGTACGAGGCTCTGCTGAA
CATAAAGATGAAGCTGGAGGCAGAAATCGCCACCTACAGG
AGGCTACTGGATGGTGGAGACTTCAAACTCCAGGATGCTC
TTGAAGAGCAGAAGAAGGTCAAAGTGATGACGGTCACGCA
GACGCTGGTGGATGGAAAGGTTGTGTCCTCAAGCACAGAA
ACCAAGGAGAGGAAACTTTAAACATCCAATTTCAGATGAT
GAGCCGCAACACATCAGAAAAACCTCATGGGCTATTGATA
AAACGATCTTACAACTTAACACATTAGATACTGTGTCTAT
TTATTCCAAAGTGCCTTATTGTAAGCATCTCAAAGCACAT
GTTGTGTGCAATGAGATTTAGCCAGTACATTTCAACATTA
ATTAAAAAAAACTTACATTTTAATAACTACATCCAAAAAA
GACCAAAGGTCACAGAACACTACGAAAACCTTTTAGATAT
TTTTGTAATGACAGTAAATGTTTACGATCACCAATTGTTC
CATTTTGTTCTATGTTGTGTTGTTGTCATGATGTCTAGTC
TTTTCCAATAAAAGACACTTTTAACAAAT

krt18a.1 TRANSCRIPTS
Type Name Length (bp) Analysis
ncRNA krt18-002 (1) 596
krt18-003 (1) 757
mRNA krt18-201 1749
SEGMENT (CLONE AND PROBE) RELATIONSHIPS
krt18-201 Contained in:

OTHER krt18-201 TRANSCRIPT PAGES
  • Vega_Trans:OTTDART00000026923 (1)
  • Ensembl_Trans:ENSDART00000127667 (1)
  • PROTEIN PRODUCTS No links to external site
    ZEBRAFISH SUPPORTING SEQUENCES
    Type Accession # Length (bp/aa) Analysis
    RNA GenBank:BC045869 (1) 1754 bp
    GenBank:BC065848 (1) 1712 bp
    GenBank:AJ493269 (1) 1463 bp
    GenBank:AW567150 (1) 560 bp
    GenBank:EB846710 (1) 548 bp
    CITATIONS (2)