header logo image header logo text
Downloads Login
Research
General Information
ZIRC
ZFIN ID: ZDB-TSCRIPT-090929-9509
Transcript Name: tnnt3a-002
Previous Name:

Add new Alias

Alias
Attribution

Attributions for Alias: {{control.newAlias}}

{{pub.zdbID}}

Delete Alias:

(Including Attributions)
Transcript Type: ncRNA
Annotation Status: retained intron
Strain: TU
Non Reference Strains:
Associated with Genes:
SEQUENCE
OTTDART00000026918 (1) [ Show ] (double-click sequence to select) [Download]
Select Analysis Tool
>tpe|OTTDART00000026918|OTTDARG00000021237|ZDB-GENE-000322-3 tnnt3a|no_translation tnnt3a-002 LG_ BX004812.8 Danio rerio protein_coding KNOWN, 370 bp
ATGTTTGCTGAACTTTACAGCCAGTCTCCACCAACAGGGA
GCTCACTTCCTTCAGCTTTCCGAGTCTCAAAGTCCACTTT
CAACATGTCAGACACAGAGGACATTGAGCAGCATTTCGAG
GGTGAGTAATTTTTCTCCAGTAGAATCTTATTTTTATTTA
GGTAATGCAAATATTTGTTATGTCAGTATCAGTTCTCCCT
ATTCGTTGTTCATTCTTCATTGTATTGCATGGCGTTGTGC
AATCTGTGGTTTTATTACCCATAAGTTAAATTGAAAGGCA
TTTGCTTTGCATATAGGATACAGTACGACTATTTACACTT
TTTTAAAAATGTTTATTTAAAACACACGGTTGGTTAAATT
TTTAAATACA

tnnt3a TRANSCRIPTS
Type Name Length (bp) Analysis
ncRNA tnnt3a-002 370
mRNA tnnt3a-201 (1) 1138
SEGMENT (CLONE AND PROBE) RELATIONSHIPS
tnnt3a-002 Contained in:
OTHER tnnt3a-002 TRANSCRIPT PAGES
  • Vega_Trans:OTTDART00000026918 (1)
  • PROTEIN PRODUCTSNo links to external site
    ZEBRAFISH SUPPORTING SEQUENCES
    Type Accession # Length (bp/aa) Analysis
    RNA GenBank:EB857749 (1) 374bp
    CITATIONS (1)