header logo image header logo text
Downloads Login
Research
General Information
ZIRC
ZFIN ID: ZDB-TSCRIPT-090929-9501
Transcript Name: dldh-201
Previous Name: dldh-001

Add new Alias

Alias
Attribution

Attributions for Alias: {{control.newAlias}}

{{pub.zdbID}}

Delete Alias:

(Including Attributions)
Transcript Type: mRNA
Annotation Status:
Strain: TU
Non Reference Strains:
Associated with Genes:
SEQUENCE
OTTDART00000026909 (1) [ Show ] (double-click sequence to select) [Download]
Select Analysis Tool
>tpe|OTTDART00000026909|OTTDARG00000021231|ZDB-GENE-040120-4 dldh|OTTDARP00000022061 dldh-001 LG_ CR376804.6 Danio rerio protein_coding KNOWN, 1806 bp
CTAATGCGCATGCGTTAATTTGCAAGTCCTTGGACACAGC
AATCGCTGTAGGTGAAGCGGTCTCGGAAGGGACATACTGT
CAAAATGCAGAGCTGGAACCATCTGTACCGCACACTCGCT
ACGCGAGGCCAGCACCTTCCTTGCAAGCTGCATGGAGCCA
CAGTCTTGTCTGCGAGAACGTATGCTGACAAAGCAGCAAT
TGATGCTGATGTCACAGTTGTGGGCTCTGGACCTGGAGGA
TATGTTGCCGCTATCAAAGCAGCTCAGCTTGGGTTTAAGA
CAGTATGCGTGGAAAAGAATGCAACCCTTGGAGGGACGTG
CTTAAATGTGGGCTGTATCCCATCAAAGGCTTTGCTAAAC
AACTCATACCTGTATCACATGGCACATGGAAAAGATTTTG
AAAGCAGAGGCATTGAAATTCAGGGCATCTCATTGAACCT
GGAGAAGATGATGGCACAGAAGAGCGGGGCGGTCAAAGCT
TTGACAGGCGGGATTGCACACTTATTCAAACAGAACAAAG
TAACTCATGTAAATGGCTTTGGAATGATAACTGGCAAGAA
TCAAGTGACTGCAAAGACTGCTGATGGAGAACAAGTCATT
AACACTAAAAACATTCTCATCGCTACTGGATCAGAGGTCA
CACCCTTCCCAGGCATTGAGATTGATGAAGACAGTGTTGT
GTCATCCACTGGTGCTTTGTCCCTCAAGAATGTTCCTGAG
GAACTTATTGTGATTGGAGCAGGAGTCATTGGTGTGGAGT
TGGGTTCTGTATGGCAGAGGTTGGGTGCCAAAGTTACAGC
AGTGGAATTTCTTGGCCATGTTGGTGGTATGGGCATTGAC
ATGGAGATCTCTAAGAATTTCCAGCGAATTCTCCAAAAGC
AGGGCTTGAAGTTTAAACTGAGCACCAAGGTCATGGGTGC
CACCAAAAGACCTGATGGCAAAATTGATGTGGCTGTGGAA
GCTGCAGCCGGTGGCAAGAATGAGACACTCACCTGTGATG
TTCTGCTGGTCTGCATTGGCCGTCGTCCCTTCACTGGAAA
CCTCGGCCTGGAGTCTGTTGGTATTGAACTGGACAAACGT
GGGAGAATCCCTGTTAATGGCCGCTTTCAGACCAACGTGC
CCAATATCTATGCCATCGGAGATGTAGTAGCTGGACCCAT
GTTGGCTCATAAAGCAGAGGATGAGGGTATCATTTGTGTG
GAGGGAATGGCAGGAGGAGCCGTCCATATTGACTACAACT
GTGTGCCCTCTGTTATATACACACATCCTGAGGTTGCCTG
GGTCGGCAAAACTGAGGAACAGCTTAAAGAGGAAGGTGTG
CCATATAAGGTGGGCAAATTTCCTTTCGCGGCTAACAGCA
GAGCCAAGACGAATGCTGATACAGATGGACTGGTAAAAAT
CCTTAGCCACAAGGACACAGACAGGATGCTGGGAGCACAT
ATTCTGGGATCGGGAGCGGGGGAGATGATTAATGAGGCTG
CTTTGGCTATGGAATATGGTGCATCGTGTGAGGATGTTGC
AAGAGTGTGTCACGCCCATCCCACTGTATCAGAGGCCTTC
AGAGAAGCTAACCTTGCTGCTTCGTTTGGAAAAGCTATCA
ACTTCTAGATTTTCTTCACTCAAAATTGTATATAAATACA
GTATCTGCTGCATTTTTTCCAAGTCCACACAGTCTGGAGT
TCTTCAGTCTCTGTTTTTATTTTTCCAGATGTACCCTTCA
TCCATACTTGCAGATTAACTCTGTAAAACACTTAGTCTGA
TATTTAAATGTCCTAATAAAGGAGTTGGATCTAATGTTGA
ACTTAA

GBrowse:
SEGMENT (CLONE AND PROBE) RELATIONSHIPS
dldh-201 Contained in:
OTHER dldh-201 TRANSCRIPT PAGES
  • Vega_Trans:OTTDART00000026909 (1)
  • Ensembl_Trans:ENSDART00000006709 (1)
  • PROTEIN PRODUCTSNo links to external site
    ZEBRAFISH SUPPORTING SEQUENCES
    Type Accession # Length (bp/aa) Analysis
    RNA GenBank:BC044432 (1) 1805bp
    GenBank:BC065616 (1) 1787bp
    GenBank:AY391421 (1) 1758bp
    GenBank:CV491463 (1) 786bp
    CITATIONS (2)