Transcript

ckmt1-202

ID
ZDB-TSCRIPT-090929-9496
Name
ckmt1-202
Previous Names
  • ckmt1-002
Transcript Type
mRNA
Annotation Status
Associated With Genes
Strain
TU
Non Reference Strain
Genome Resources
RNACentral
Note
None
Sequence
OTTDART00000026901 (1) [ Show ] (double-click sequence to select) [Download]
>tpe|OTTDART00000026901|OTTDARG00000021227|ZDB-GENE-030131-611 ckmt1|OTTDARP00000022054 ckmt1-002 LG_ CR450696.6 Danio rerio protein_coding KNOWN, 812 bp
ATATGATCTGTCGCTTGTTTTATGGTTAACGAATCGTTTA
TTGTTCCCCTCAAAACGTCAGTACATTAATATAGAAAAGT
CACCGTATAATAAAATGTGTAGCCTATGTAGTCTATTCAA
GGTTGTTGAGTGGTTTACGGTAATAAGGGTGTGAGAAGTT
GGTTCTCGACGAGTTTCTGAATAATCTGATTGTGAAGCTG
CTCAAAGGAGGGAGGGCGAGCTTGTACTGGGAGAAGGACA
TTTTATCCGCAGCATTCCTGCATCCTCCAGTAATCCCGGT
GTCTATCCTTCTGTCTCTCCATCCTTCAAGACCACATTCA
TCTGGAGTGCTCTGTTCTGCGGTTGAGGTGTTAAAATGGC
AAGCAGCTTCGCACGGATTTTGTCAGGTAACAGGAAGGTT
GGCATCTTGTCGCTGGTCGGTGCGGGATCTCTGACCGTCG
GGTTCTTCTTGAACAGGGAGCAGCATGTCAGCGCAGGATC
GAGCGTCCGGAGAATCTATCCCCCGAGTGCTGAATATCCG
GATTTGCGTAAGCACAATAACTGTATGGCCAGTCACCTGA
CTCCTGCCGTATACGCAAAGCTGTGTGATAAATCCACTCC
GAACGGTTACACTTTGGACGAAGCTATTCAGACTGGTGTG
GACAATCCAGGTCATCCTTTCATAAAGACAGTAGGAATGG
TGGCAGGAGATGAAGAGTCATATGAGGTATTTGCTGACAT
CTTTAACCCAGTCATCAAAGAAAGGCACAATGGTTATGAC
CCCTGCAACATGAAACACCCCACTGACCTGGATTCCAGTA
AGATACGAGGAG

Segment Relationships
Protein Products
No data available
Supporting Sequences
Citations