header logo image header logo text
Downloads Login
Research
General Information
ZIRC
ZFIN ID: ZDB-TSCRIPT-090929-9474
Transcript Name: kdrl-201
Previous Names: kdrl-001, ottdart00000026879, zfinnucl0000000357, zfinnucl0000001261

Add new Alias

Alias
Attribution

Attributions for Alias: {{control.newAlias}}

{{pub.zdbID}}

Delete Alias:

(Including Attributions)
Transcript Type: mRNA
Annotation Status:
Strain: TU
Non Reference Strains:
Associated with Genes:
SEQUENCE
OTTDART00000026879 (1) [ Show ] (double-click sequence to select) [Download]
Select Analysis Tool
>tpe|OTTDART00000026879|OTTDARG00000031823|ZDB-GENE-000705-1 kdrl|OTTDARP00000047785 kdrl-001 LG_none BX247946.6,CR759732.10,CR812836.4 Danio rerio protein_coding KNOWN, 5790 bp
GGGAAAAGCCCAGTAGAAAAGTCAGAGGTATAGTGGGATG
GTGTGAAGATAGATAAATGGCTGTTACACCTTCACTACAT
AGTGTAGTTTTGGAAATTTCATTCATTCGGTTTTAGGAAG
GACGGACAGCGGTCGCACCTGCCCTCGGGAGTTGTGGAGT
CAGTGGAGTTTCTCCATTCGTCTTAGTACCGGGGCAGGCG
CAGTCCTGCGCGATACTTTACAGTCACTGAGAGGTGTTTA
ACTATTAACACGTCACCGAAGAACCATCTCTATCATATCA
ACAGGAACTATAAGCATATTATCATACATCAAGAGAAATT
AAGTTCTGGACTACTGCAGCCGCATCCGAACGTGAAGTGA
CATACGGAGTATCATTCGGGACGTTATTTTAACAGACAAA
ATGACTCCTCTTAAAACCTCAGTCAAAGCCTTCTTCACTC
TTCACGTGCTTTTTAGTTGTATTTCACATGGTTTGGTAGA
GGGATCTCGTCTGCCTGATCCACAACTGCTTCCTGATGGA
GATACACACCTTCAGCATGTTGGTGGGACACTCACACTCA
TTTGCAGAGGATCAACTGCACTGCACTGGAGGCTGGCTAG
CAGAAATGTGTCATCGGTACGCATTGAGTCGTGTGAGGAG
AGACTGCACAAGCACTGCAGCAAGCTAGTCATACACAACT
TGAGGCACAACGACACTGGCATCTACTCATGCAGTCACAA
GAAGTCCAGCGATCATGAAGTGTCCACATATGTTTTTGTT
AAAGATCCCCATCATCCATTTGTGGAGGCTTACAGTTTAC
CACATCCGCTTTTTGCATATCGAAATGATCCATATTTTGT
GGTCCCCTGTAGAACAACATACCCAAACCAAAACGTTATC
CTTGAGACGCAGATGAATCCTATGGCAGATGATGTTAAAA
GAGGGGTACAGTGGGATCCAAAAAAAGGTTTCACGGTCCC
TTTAAAACCTTATGACAGCTACCATCTAATTACATGCTTG
ACCAGGGTGGATAACGCAGAATTTTCATCAGTCTACCTAC
TTAAAAGGCTAACAATGGAAATTAAAAACCTTGCCATCGA
ACCAGAAAGACCAAGAGTACTTGTCGGTGACACCCTCATC
CTCAACTGCTCTGCAGAGACCACTTACAATGGCAGGATTC
ACTTTGAGTGGGAGTTTCATAAGGAGCGGATCAATCGTCC
TCACCATTTTAGCACCACACCGGTCCAACTTGCCCAGATT
ATGGTGATGTCTAAAGCATTAATCGTGCCTAATGTGACAA
TGGAGGACAAGGGCACATACACGTGCACAGGATCAATTGA
ATTTAAAAAGCTTCAAATGTCAACCAAAGTTATTGTTTAT
GAACATCCATTCCTCAATGTTACTCATAATAAACGTAAAT
TCACCTCTACTGTAGAAGGTAGAAGGGTGCAGTTTGAGCC
TCGGGTCAATGCTGTTCCTGCGCCCGACAGAGTCTTGTGG
TACAAAGATGGAGTGGCCATTTCTGAAAATTCCACATGTT
ACGAAACTGCAGGCTACAACCTGACCATAAAACAAGTGAG
GCAGAAGGATGCTGGGATTTTCACTATCGCTCTGTCAAAC
CAGGAGAGGGGTCTCTACAGAAACATCAGTTACAAGCTTG
AAGTCAGAGTGAAGCCAAAGATCTTTGAAGAGGATGTGGC
TCCAGCAGGTCCCCAGACCTTCAGATATGACCAGAGGCAC
AAGCTCACCTGCACTGCATTTGGTATTCCCATGCCGAACA
TTACCTGGTTTTGGCAGCCATGTGACCCCAGTGCTAATCT
TACAGAATGCAAACTTTACACTGATCCTCTTCCCATTGAA
AACGTTGATGATTTTCCTCAAAATCCGATAAAGGATGTAA
ACAGCAAGGTTGGATTGTTAAAAAGTAAAAACCGGACTAT
AAGTACCCTGGTGGTGAAAACAGCTAATGTGTCTGGGGTC
TACTCCTGTACAGCAAGGAATGAACTTGGCAACCGGACCA
TGAGAATCCCTTTTTATGTGGATGATCACCCACAGCCTTT
TGAGATTGAGCCCTCCACTGCGGTTGCTGGAGATGACATT
ACATTGACTTGCAGAGGCACAAGATACCTCTACGATAGGC
TGACTTGGTATGATCCTCTGGGCTATAAGGTGCCCAAAGA
TGAAACCACTCTGCGGATTGAGCCCTACACTATATCTTTG
TCAATCAAGCTGCCCAATGTTTCCAGAAACCATACACTCG
GCTATGAGTGCCAGGCTTTAAACATCAACACCAATAAAGT
GGTCAATGTAACATCTGCTTTGACTATTGATGAGAGGCAA
GGGCCCTGGTTAATGCAGAATCTGACCAATCAGGATGTAA
ACAGCAGCAGCACCCTAACACTGGCCTGCTTGGCGTATGG
AGTTCCAGCACCCTTTATCACATGGTACAAAGACAAGACT
CCTGTCACAGAGGGACCAGGAATCACTCTAAAAGATGATG
GCACTCTAATTATTGAAAGGGTGAAGAAGGACGATGAGGG
CATTTATGAATGTCGTGCTAGCAATGATGGAGGGGAGGCA
AAAACCAGTGCGGTCATTACTGTAGTAGGAGAAGATGGTA
AACCAAATATTGAGGTCATCATCTTGGTGTCGACTGGAGC
AGCAGCAACATTCCTGTGGATTATGCTCATTCTCTTTATC
CGCAAATTAAGAAAGCCAAGTTCAGCAGATTTGAAGACAG
GGTACCTGTCCATCATCATGGATCCTGAACAGATGCCTCT
CGATGAGCAGTGTGACCGTCTACCATATGACAGCAACAAA
TGGGAGTTTCCTCAAGATCGCCTCAGACTCGGTAAAACTT
TGGGCCATGGAGCATTTGGAAAAGTTGTAGAGGCCTCTGC
ATTTGGCATTGACAAGATTTCAACATGCAAAACAGTGGCT
GTGAAAATGCTGAAAGTGGGAGCAACAAATAACGAATGGA
GAGCCTTAATGTCTGAACTGAAGATACTGATCCATATTGG
GCATCATCTCAATGTGGTTAACCTGCTAGGAGCCTGCACA
AAGCGTGGCGGCCCCCTAATGATAATCGTGGAATTCTGCA
AGTATGGAAATCTTTCCAACTACCTGAGAAGTAAGAGAGG
TGACTTTGTGGTTTACAAGTCTCAGGACGGTAAGGCTGTG
CGTTCCAGCTCAGGCTGTGATCTGAGCGAGCTCATCAAGC
GCAGGTTGGAGAGCGTGGCGAGCACCGGAAGTTCAGCCAG
CTCCGGCTTCATTGAAGATAAGAGCTACTGCGACTCGGAG
GAAGAGGAGGAAGAGCAAGAGGATTTGTATAAGAAAGTGC
TCACATTAGAAGACTTGATTTGCTACAGCTTTCAAGTGGC
TAAAGGCATGGAGTTCTTGGCTTCGAGAAAATGTATCCAC
CGTGATCTGGCTGCACGTAACATCCTGCTGTCTGAAAACA
ATGTTGTGAAGATTTGCGATTTTGGACTTGCAAGAGATGT
ATACAAGGACCCAGACTATGTCCGCAAAGGAGACGCTAGA
CTTCCCTTAAAGTGGATGGCGCCAGAGGCCATTTTTGACA
AGATCTATACTACTCAGAGTGACGTGTGGTCTTTTGGAGT
GCTTATGTGGGAGATCTTCTCTCTTGGTGCCTCCCCTTAC
CCTGGCTTACACATTGATGAGGAATTCTGCTGCCGACTGA
AGGAGGGCACTAGGATGAAAGCTCCTGAGTACTCCTCCTC
TGAAATATATCAGACCATGTTGGACTGCTGGCATGGAGAA
CCATCTCAGAGGCCCACTTTCACAGAGCTGGTGGAGAGGC
TAGGAGATTTGCTACAGGCTAGTGTGCAGCAGGAGGGAAA
GCACTACATCCCGATCAACACGGCCCTCTTGACCAAAGCA
GACCCCTCAAACCAGAGTCCCACAGAGGAGACCTCCACAC
GACCAGTCTCTCTCAGAGACTCTGGGACGGCTTGGAACAT
CAAGATCCGCCCAGAGAGTGTGAAGACCTTCGATGAAGTA
ATCCTGGAGAACGGAACCAACAAGATCCACGAGGGTGGGC
AGTCAGACAGTGGGATAGGACTATCTTCAGATGACCTGAA
GACGCTGAAGCGGCTGGAGTCCCTGGCCCGACCCCGGAGT
TTCATGTCCCGAGCGATGAAGAGGAAAAGTAAGGAGTCAG
TTCTGCTGGAGGGCGAAATGGACAAATACCCACCGCTTGT
TCCCTCACTGAGTCTGGAGGACTCGTCCCTTGACTCGGAG
ATGGAGTGTCACAGTCCTCCTCCAGACTATAACTATGTGG
TTCGTTACTCCACACCACCCGTCTGACATGCTCTGCGCTG
GAAAAGCCGCCAGAAGTCTGATCGGTCCATTCTGTCTCAT
TCTGTCTCTGTCTCTACTTTTATTTTTCCCACACATGGTC
ATTCAGAGATTTACATTTCCTGTACACTTCTGTCAAGTTA
GTGAAGGAGTACAGTCGGCTGCCACTCATATCTGTGGTAG
TGTAAGATTCATATGGACCAGCTCAGGTATTTCTGCTGTC
TACTGTGAACACAACAGGCACATTTTATTACACTAACAGC
ACTGTTTCCCCATTGAAAATGCATTCTTCAGTCAGAATGG
TGGCTAATTATGAAATCATTAGTTCGGTGGTTAGAGCGAG
AGGACAAAGGCAATCCTTATTTTATTTCTAGATAAATATT
TTATTGAAATGAAACTGGAATTTTGGTTATGTGATATTTT
ATTTTGCTAAACGTATTCTTTCAGAGCTCGCTAAAGCTTC
TTCTTTGAAAGGGAAAAACTATTTTTCTTTAGAACAGATT
TCACTCAAACTTTCAGACAAGCTGTCAAACAAAGACCACA
GATCATGAATAATTTAACATGCGGTCAGAAGCTCCTTCCC
AGATCTCCATCACGGCACATTGATCATCAGCATACTTATG
ATGCACATTGTGTTTCCAGGTTCAGTCGCACCAGTCTGAG
GGCTGATTTCCTGAGTCTTACTCGATAAAGCTAAAATGAA
TCACTTCTGTTCCCGCTTGTGCTATTTTTATCTGGTAAAC
ATCTTATAATATGGTTAATTTAGTTAAAATTCAGTTTAAG
ATCTTCAACTTGCTTATGGATGCCACAACATTCAGTCCAT
CACTGTGAAAGTAAATTACTCATGCCAATTTCATAGGAAA
CATTCAGTTAATTATTGATCAAATGTGGATGATATAAAGG
CCTTGCTCTGTTCAATACACAACAGTTACACTGCATCGTG
TACTTTCCATATTTATTTCGTTTACACTACTGTATACATA
ACAGCACGTAATATGTTGTGCAGCTATTAACCAGAGGAGC
GTATCCTGTTACTGATTCAGTAGTCGTTTGTGCTAAAATG
CTACTAAAGCTTGCAGGGCAGGCTATGATATTGTCAACAG
GCTGGTCACTATATTAATGTTCATGAAAATGATATGCACA
CATGATGTAGGTGCTATCAGTATTAACTCCTTAACATCTG
TATGTACGTAAGGGAAAGGTTGAGAGATTATCGTATTGGT
TAAGCCAGATTATATTGACTGTGTAAAGGGCCCTTTGCTA
ACCGTTATCGTGTTTAAATCCCAGTATTACATTCATAGCT
GATGATGTCTTCCAAATAATGAAATGTGTATATACTGCCA
AATGATGCTTTTCATAATGTTGTTATTTTGACTGATATTT
GTGAAGCAAAATTGTATGCACTGATATTTTCTACACGTAT
GTATTTTTTGTATTATAACTGTATTTTAATATTAACCAAG
CATAAATAAAGATCTATATATTTATATTTA

GBrowse:
SEGMENT (CLONE AND PROBE) RELATIONSHIPS
kdrl-201 Contained in:

Genome Resources: Vega_Trans:OTTDART00000026879 (1),  Ensembl_Trans:ENSDART00000170626 (1)
PROTEIN PRODUCTS No links to external site
ZEBRAFISH SUPPORTING SEQUENCES
Type Accession # Length (bp/aa) Analysis
RNA GenBank:CU458916 (1) 5784 bp
GenBank:AF487829 (1) 5505 bp
GenBank:AF180354 (1) 5037 bp
GenBank:AY056466 (1) 3906 bp
GenBank:CA471418 (1) 901 bp
GenBank:AL914779 (1) 453 bp
CITATIONS (2)