header logo image header logo text
Downloads Login
Research
General Information
ZIRC
ZFIN ID: ZDB-TSCRIPT-090929-9473
Transcript Name: cdx4-201
Previous Name: cdx4-001

Add new Alias

Alias
Attribution

Attributions for Alias: {{control.newAlias}}

{{pub.zdbID}}

Delete Alias:

(Including Attributions)
Transcript Type: mRNA
Annotation Status:
Strain: TU
Non Reference Strains:
Associated with Genes:
SEQUENCE
OTTDART00000026878 (1) [ Show ] (double-click sequence to select) [Download]
Select Analysis Tool
>tpe|OTTDART00000026878|OTTDARG00000021212|ZDB-GENE-980526-330 cdx4|OTTDARP00000022034 cdx4-001 LG_ BX247946.6 Danio rerio protein_coding KNOWN, 1638 bp
AGACTCACATCATGTTTGATTGAAGCACGTCAAGGACTAC
GTCGCGTGACCCGGAGCTCCTTTTGGACTATTACACTTCC
AGATAAATAGTATTGAAGAAAAAGTTTTTGAGTCGGGCCT
TGGATCCAAGTGATATTTGGCTTGATGCATGGCTGGCATG
TTGCCTTAAAAAAAGTTATTTTAGGGGTTTCTTCCAAATC
ATGTACGTTGGATACCTTTTGGAGAAAGAGGCAAGCATGT
ATCACCAAGGAGCGGTTCGTCGATCTGGCATCAGTCTTCC
ACCACAGAACTTTGTTTCCACACCTCAGTATTCAGATTTT
ACAGGATACCATCATGTGCCCAATATGGAGACACACGCAC
AGTCGGCAGGGGCATGGGGCGCTCCTTATGGCGCTCCGAG
AGAGGACTGGGGCGCCTACAGCCTCGGACCTCCAAATTCT
ATTTCTGCACCTATGAGCAATTCATCTCCGGGACCAGTTT
CCTATTGCTCGCCCGATTATAACACCATGCACGGCCCTGG
ATCGGCGGTTCTTCCTCCACCACCTGAAAATATTCCTGTG
GCCCAACTATCCCCAGAGAGAGAAAGGCGTAATTCCTATC
AGTGGATGAGCAAAACCGTCCAGTCGTCATCAACCGGCAA
AACGAGAACGAAGGAGAAATACCGAGTGGTATACACAGAT
CACCAAAGGCTGGAGCTGGAGAAAGAGTTTCATTTTAATC
GCTATATCACAATCAGAAGAAAATCCGAACTTGCTGTAAA
CCTCGGGCTTTCAGAGAGACAGGTTAAGATCTGGTTTCAG
AACCGCAGAGCTAAGGAAAGGAAATTAATCAAAAAGAAAT
TGGGTCAGTCTGACGGAAGCGGAGGGTCAGTGCACAGCGA
CCCAGGCTCCGTCAGTCCTCTACCGGTACCAGGGTCACTG
AGTCCTTCAGATATACACGGTTCTCTGTATCCAGCACAAA
TGAACGCCTTGCCGTCCATGAGGAACATACAGCAAGTTAC
TGTCACTCAGTGAACTCGAACTTGGAACATCCAACTTTAA
CTGAGCACTCCAACACGCTGAAAGGACAGAACCAAACGTG
GTCAAAAAGGATTACAAACTATTAATGAATAAATGAATGA
ATAAATAAATAAGAGGCGTGGGTTGTGGATTACAACCGAA
GAATCACGTCTGAAATGCGACGAAATGCTGGAGGCTCTTC
AAATATTGTTTTAATAGAATAGTTTTTAAAATTAAGAAAA
AAAACTACAAAAACCTTGTTCGTCTGATCCAGAGACTAAA
TATTTTAATGGTTTGTGTTTTCTCGAATAAGATATAAATA
TCTTTTTTCTGTATGTGGTGAGTGTATCTAAATGTTTGTT
TGTATATAAAATGAGAACTACAGGTACGGAGTTTCATGGG
ACGTGTAATGATCCTTACCCTGGAACTGTTAAACTTTTAT
TGTCTGTGAAAACCAATGACCTGCGATGTCAGGCTGTTTT
ATGCGCCAGTTTGTGTCCAAAGCGCACGTCGTTCACTTTC
TTTTCACAGGGGTGATGTGCAGGTGTCACATACCAGATAC
GGGTATAACGTTTGATTTCAGCAATGTGTAAATAAATGTT
TTGCAATAACTTTTATTGTGTCTTCATGTATCATTAAA

GBrowse:
SEGMENT (CLONE AND PROBE) RELATIONSHIPS
cdx4-201 Contained in:

Genome Resources: Vega_Trans:OTTDART00000026878 (1),  Ensembl_Trans:ENSDART00000114973 (1)
PROTEIN PRODUCTS No links to external site
ZEBRAFISH SUPPORTING SEQUENCES
Type Accession # Length (bp/aa) Analysis
RNA GenBank:BC160643 (1) 1684 bp
GenBank:BC154241 (1) 1625 bp
GenBank:BC076488 (1) 1621 bp
CITATIONS (2)