header logo image header logo text
Downloads Login
Research
General Information
ZIRC
ZFIN ID: ZDB-TSCRIPT-090929-9467
Transcript Name: ralaa-201
Previous Names: rala-001, ralaa-001

Add new Alias

Alias
Attribution

Attributions for Alias: {{control.newAlias}}

{{pub.zdbID}}

Delete Alias:

(Including Attributions)
Transcript Type: mRNA
Annotation Status:
Strain: TU
Non Reference Strains:
Associated with Genes:
SEQUENCE
OTTDART00000026871 (1) [ Show ] (double-click sequence to select) [Download]
Select Analysis Tool
>tpe|OTTDART00000026871|OTTDARG00000021207|ZDB-GENE-040426-1344 ralaa|OTTDARP00000022028 rala-001 LG_ BX005461.9 Danio rerio protein_coding KNOWN, 5261 bp
GCGCAGACCGCCGTGCGCGCTTCCCTACCCTGCCTGCATG
GAAAACCGAAACGGATCCATGTGACCCGCCTATCGGGATC
CTCATCAGCTCCACACCCGTGATCTGTGAGCTTCTGCCGC
CGACACACCGAAGATCACGGCGATCCCAGACGGAAGTGCA
GTCTGAGGGCAGCGAGGCCGGTTCCGGTGGCGTTTTTCGG
GATGCAGTGACAGGAATCTCAGCTTCCCGGGAGTCCTTGT
GTTTCTGGATTACCTTTAGCTGAACGAGCAGACACAAAGG
TACAATTGGGGCAGTGCATGGTCTTCTCTCCGTCAAACTC
CCACCTTGACCCCTGGCTTCACTGACCTTTGACCTGGTAC
CCTGACTCTCTCCGCTCAGTCCTGCTCGATCTCCTGTTAT
CATGGCGGCAGCGAAGCCCAAAGGGCAGAACTCGCTGGCT
CTCCACAAGGTGATCATGGTGGGCAGTGGCGGTGTGGGAA
AATCTGCTCTGACACTGCAGTTCATGTATGATGAGTTTGT
GGAGGACTACGAGCCCACGAAAGCAGACAGCTACAGGAAA
AAGGTGGTTCTGGATGGAGAGGAGGTTCAGATAGATATCC
TGGACACGGCCGGACAGGAGGATTACGCTGCGATTCGGGA
TAATTATTTCCGCAGCGGGGAGGGATTCCTCTGCGTTTTC
TCCATCACTGAACTAGAGTCTTTTGCAGCAACTGCGGATT
TCAGAGAGCAGATCCTGCGGGTGAAGGAAGATGAAAACGT
GCCCTTTCTTTTGGTGGGAAATAAATCTGACCTGGAGGAC
AGAAGACAAGTGAGCGCCGACGAGGCCAAAGCCAGAGCGG
ATCAGTGGGGTGTTTGCTACGTGGAGACGTCTGCTAAGAC
CCGCGCCAATGTAGACAAGGTTTTCTTCGACCTCATGAGG
GAAATCCGCGCCAGGAAGATGGAGGACAGCAAGGAGAAGA
ACGGCAAGAAGAAGAGGAAAAGTCTGGCCAAGCGAATCCG
CGAGCGATGCTGCATTTTATAGTGTCCGTGCTGGTTTTCT
CTCTCCGTTTGGCAGATGTATGTGTATGTTCTCTGTTTCT
GCTGCCAGTAATCCTCATCTGCGGTGTCTCCTGCTGTTTG
TGTGTCAGATGTGGGCTTCTCCGAAGGACCAGGACAGTCT
GAACTCTTAGATCGATGCGGTAGAGTGTCTTTTATTCGGT
AATATTGTCCAGAAGCGCAGGACTCGGCCGGTCTGTGTGG
ACTCGCTTCCATAAAGCTCCTGCGCAACACGCAGATCCGA
GAGCTCTTTTATTTTATTCACGTGTCAGATGTTTGTTTTA
CGGGCTGTCAGGCCACCTCTTTGAGTTTAATGGCTGTGTT
TTGACATCAGTCTTGGGTGATCCAGTGTCGGATTAATAAA
TAGAGATGAACAAGACGGCAGAAATGTTTGATTCAGTCAC
CTCTCTTTCAAATGCTCATCAAGGGTGCAGTTATGGGATC
AAAAATAATGTCGTATCTGCAGCTATAGTGCAATTAGATC
CACTGTAAAATAAATAAATAATGTTATTGTGTGTTCATTA
GGGTTGGGCGATGTCGACCAATTTGGCATCGTACGATGTC
TAATGTGAAACATCGCGATGGACGATGGCATCGTCGTCAT
AGGCAGAGGTGAATTAATTTTTTAGGAATAATTTATTTAT
TTATAACGAATTTATTATTTGTAGCCTACCTTTTCAACTA
CCTGACCCGCAAGGTCTATGTTTTACCTATAAACACACAC
ACACAGATTACCACCTGTCAATCACTTTTTCACCACAACA
GATCAAACAGGCCTGCTAAAGGTGTTGTGTTACCATAGCA
ACTGTAGAATCACCACAACAGATCAAACAGGCCTGCTGAA
GTTGTAGTGTTACCATAGCAACTGTAGAATCAACACAACA
GATCAAACAGGCCTGCTGAAGTTGTAGTGTTACCATAGCA
ACTGCAGAATCGGCACAACAGATCAAACAGGCCTGCTGAA
GTTGTTGTGTTACCATAGCAACTGTAGAATCAACACAACA
GATCAAACAGGCCTGCTGAAGTTGTAGTGTTACCATAGCA
ACTGTTGAATCAACACAACAGATCAAACAGGCCTGCTGAA
GTTGTAGTGTTACCATGGCAACTGTAGAATCACAACAACA
GATCAAACAGGCCTGCTGAATTGTTGCGTAACTATATTGA
TAAACTATATTGAGTCTTGTTCCCACAGAACTGAAGATTG
TTCTCGTTTACTCTCACTGGTTTAAAACCTTTTTGAGTTT
CTTTCTTCTGTTGAACACAAAAGAAGATATTTTAAAGAAT
GTTCAAACCTGTAACCATTGACTTCCATAGTAGTTGTTTT
CTCTACCATCGAAGACAATGGTTACAGGTTTCCAACATTA
TTCAAAATATCTTCTTTTGTGTTCAACAGACTAAAGAAAC
TCGTACACGATTGAAACCACAAGAGGGTGAGTAAATAATG
AGTAAATGTTCATTTGTGGGGTGAGCTGTCCCTTTAACGC
CATCTTTAATGTCAAGGAATAAAAACATCTATAATGGTAG
AGATTAAAAACATCAACAGCCAATCAGAATCTTGATTTGC
AGAGCTCTGGCATTTAAAGGGGCATGCACACATTTTTGAT
TATGTGGACTGAAATATAGTTCTGGTTCTTGGTGTGAGCA
GGCATTTATGGAAACCCATTTCCACCACAAGACAAAAAGA
AGGTAATCACATCTTATATCTTACTATTTCCCTCACAATT
TCCTTTCCAATAGAGGCTTTTTTAGATACTTTATTTTTTG
CACCTCACAACTCCTAAGTTAATCATTTTATTTTACAAAT
AATAATAATAATATATAGTAATTTGACATTTGCACTTCTC
ACAATTCCGAGTTTATAAGCTTTTTGGTTACACTTTACAA
TAAGGTTGTGTTAGTTAATGACAATACAGTTCTTCACATT
AGCTCACGGTGGGTCCAGTTTTTATCAAGTTACCCACCGT
ACCTCAAACTCCCCGCTGGAGGGGTTTCAGGGCAAACACG
ATGTATACAACTCAAGCCACTGTTGAACTTTTATTTTGTA
CAAATACACAAACTAGGCAGCCTGAGTACTGACGTCACAC
TAGTTTGTCAAACTTCGACGTTCCTCCTCGTTTAATTAAT
TAAACAGTTGCAAGCGTACCAGCCCTGAACAATAATTAAC
TGAGAGAAAAAAAAAAACATGCGTCTTGACCCATACACGG
ACGCAACCTATTGGCTGGGAACAGTAATACACATATCCAT
AATCTATTAGAATTATGACGTATATGAAAATACAACATGA
ATGTGCCTGCACTTAAACTAACATGGTAAATATACATGCT
TTTTTTTCAAATACTCTGGAACATAATAACATCTAGCATT
ATTAATATGCAGTTAAAGTCAGAATTATTCGCCCCCCTTT
GAATTTAATTTTCTTTTAAAAATATTTCCTAAATGATGCT
TCACAGATTCAGGAAATTTTCACAGTATGTCTGATAATAT
TTTTTCCTCTGGAGAAAGTCTTATTTGTTTTATTTTGGTT
ACAATAAAAGCAGTTCTTAATTTTTTTAAAGCCATTTTAA
GGTCAATATTATTAGCCCCTTTAGGCTATATTTTTTTGAT
AGTCTACAGAACAAACCATCCTTACACAATGACTTGCCTA
ATTACCCTAACCTGCCTAGTTACCCTAGTTCAGCCTTTAA
ATGTCACTTTAGGCTGTATAGAAGTGTCTTGAAGAATATG
TAGTCTAATATTATTTACTGTCATCATGACAAACAGAAAA
TACATGAGTGATTAGAGATTAATTATTAAAACTATTATGA
TTATAAATGTGTTGAAAAAGTCACTCCGTTAAACAGAAAT
TGGGGGGAAATTAATAAATATGGGGGCGAATAACTCTGAC
TTCAACTGTACATATGCAAACAATAGTAACAATCGTGAAT
TTGGAATGTACTAATGCATTAGTAACGTTGAACTATGATT
ATAGTAAATCCTGCACATGATTAGTTAATAACGTTAGTAA
ATATACATTAACTAATGAAACCTTGTTGTGAAGCGTGACT
CTGTTCTTCCATTGTTAAATCTCATTGTGTGTGTGGGGGG
GTAATGTGTTGAGTTTATAACTTGCAAACCAGAATTTTTT
CTTGCAATTCTGAGATTTCTTTTTAGTTAGAAGATAAAAT
GATGGACTGTTTTATGGCATTTCTATTGTTTTTTAAACAG
ATCTTGAACTTGTTTTAACAGTATTTCCTATTTTTTCTTT
TGTGGAAAGTCTATATTTCTTGTAGGTTGGCTGGAATTAT
TTATTTATTTTGATGTAAAAACTGCTGAGATCAATATTAT
TAACCCCCATAATAATTAGCTACATACAAACCACTGTTGT
CCAACAACCAGCATAATTACCATAAATAACCTAGTTAAAC
ATGTAAATGTCACTTAATGTCTGTGTGCAGTCTGAACAGC
AGAACATGTTCAGTGTAAAGTTGAATGTTTACGCGGCTTA
CATGAACTCTTAGTGATGAAAATAAAAGAATTGTTTGAAC
AAACACTCGATCTAAAAGCACACAAATGCAACGAATAAAC
ATTATCATCAACTCAGACTGATGTATTCCTGTTAAAGATT
ACGTAAGAAACGTGCAGTTAAGCATATCTAGTTTACATTT
GTTGGCAAACGAAGGAACGTGACAGCATGTGTAATGTTTA
TATGGAATAAATAACTTGCATTTGTCTGTAAAAGGGCATC
TAACAGCCACAGGTCTGATTTTTCACTCTGCTTATCAATG
CTGAGCACTATTATTTATTACTGTTTATTTATTATGTATG
CTAGTTATGTTATTTCAGTTATTTGTTTTCCATTTGTTGT
GAATTTGTCATTTGTATCAGTTAATGAACGTGTTTTCTTT
ATTAATAGTTTCAGTCTGAGTTTTGGTGTGCTGTAATAAC
CGTGTTCTGTACATCAGCAACAGAACAAAGCATCGAGTTT
CACACTCTTGATATTGTTCAACAGTAAAATAATGATAATG
AAATAACATAAAGCAAAATAATATACAGGTAAATAATGTT
ATATGTGATTTGAAACCCAGAGACGTGTAGGTTTAACCCG
TAGAGGTCATTAATGTACAGTCTGTCAGTCCAGTGATGAG
TTTATTTCTTATATTAGTTGATCTTCTGCTTTTTATACAT
GTATCGTTCGTGTGAAAGCTTATTTCAGCCATTTCAAAAT
TAAATAAACACATTTTTTTTT

ralaa TRANSCRIPTS
Type Name Length (bp) Analysis
mRNA ralaa-201 5261
ralaa-202 (1) 638
SEGMENT (CLONE AND PROBE) RELATIONSHIPS
ralaa-201 Contained in:
OTHER ralaa-201 TRANSCRIPT PAGES
  • Vega_Trans:OTTDART00000026871 (1)
  • Ensembl_Trans:ENSDART00000066863 (1)
  • PROTEIN PRODUCTSNo links to external site
    ZEBRAFISH SUPPORTING SEQUENCES
    Type Accession # Length (bp/aa) Analysis
    RNA GenBank:BC053216 (1) 1417bp
    GenBank:CK866602 (1) 876bp
    GenBank:EE206842 (1) 471bp
    CITATIONS (2)