header logo image header logo text
Downloads Login
Research
General Information
ZIRC
ZFIN ID: ZDB-TSCRIPT-090929-9412
Transcript Name: fgf13a-202
Previous Names: fgf13-001, fgf13a-001

Add new Alias

Alias
Attribution

Attributions for Alias: {{control.newAlias}}

{{pub.zdbID}}

Delete Alias:

(Including Attributions)
Transcript Type: mRNA
Annotation Status:
Strain: TU
Non Reference Strains:
Associated with Genes:
SEQUENCE
OTTDART00000026797 (1) [ Show ] (double-click sequence to select) [Download]
Select Analysis Tool
>tpe|OTTDART00000026797|OTTDARG00000021166|ZDB-GENE-041114-101 fgf13a|OTTDARP00000021964 fgf13a-001 LG_none BX511059.10,CR847845.5,CR812761.4,BX004988.5 Danio rerio protein_coding KNOWN, 1130 bp
CTGCGAAGCGCGCGTTCGGGCTCTGGAGGAACATCATCTC
CGTTATCAGCTGAAATGGCCAGATAGTGTCATTATCTGGA
GACTGGTGCGGTGTAGCTGCAGCCGACTGAATGTTTAGGC
GTTCCTGGAGTTTATCTCTGAAGAAAAAAATGAACGTTGA
AGAGATGCGCGTACATTCACCTACGTAATTGCGTTAAAGC
TTATGTTAGTTTACAACTCTTTTCTTCCGAGCTGTCATTT
TCATTAACGAACGATGGCGGTGACTGGTGTATGAGGACTT
GGATGTGAGCTTTCAAGTTAGATTTCCCTAACGAACTCGT
GTTGTGGAGGAGGTGGGCAAGCGGATTGTGCCCTCTGAAA
GTTTTGGGTGTCGCACCGTCAAACTGGCCATGGCTGCGGC
GATCGCCAGCTCCCTTATTCGGCAGAAGAGGCAGGCGAGG
GAGCGAGAGAAATCAAACGCCTGCCGCTGCGTGAGCAGTC
CGAACAAAACCAAAGGAACATGCGAGAAACCCAGTCGACT
CAGTGTTTTCTCTAGAGTCAAGCTTTTCGGCTCCAAAAAA
CGCAGGAGGAGACGACCAGAGCCCCAGCTGAAGGGGATCG
TAACGAAGCTGTACAGTCGACAGGGCTTTCATTTGCAGCT
CCAAGCAGATGGAACCATCGACGGCACTAAAGAGGAGGAC
AGTGGTTTTACCATGTTCAACCTCATACCAGTGGGCTTGC
GAGTGGTGGCCATCCAGGGAGTTCAGACCAAACTCTATCT
GGCCATGAACAGCGAGGGCTACCTGTATACATCAGAACAC
TTCACACCAGAGTGCAAGTTTAAGGAGTCTGTATTTGAGA
ACTACTACGTGACGTACTCCTCCATGATCTACAGACAGCA
GCAGTCGGGCAGGGGCTGGTACCTGGGCCTGAATAAAGAA
GGAGAGATCATGAAGGGCAACCATGTGAAGAAGAACAAGC
CTGCTGCACACTTCCTCCCCAAGCCTTTGAAAGTGGCCAT
GTACAGAGAGCCTTCTCTGCACGACCTGACCGAATTCTCT
CGTTCTGGTAGCGGCACGCCAACCAAGAGCCGCAGTGCCT
CCGCTGTGCTGAACGGGGGCAAAGCTGTGAGTCAGAACGA
GTCAACGTAG

fgf13a TRANSCRIPTS
Type Name Length (bp) Analysis
mRNA fgf13a-202 1130
fgf13a-203 (1) 2383
fgf13a-204 (1) 646
fgf13a-205 (1) 659
fgf13a-206 (1) 777
SEGMENT (CLONE AND PROBE) RELATIONSHIPS
fgf13a-202 Contained in:

OTHER fgf13a-202 TRANSCRIPT PAGES
  • Vega_Trans:OTTDART00000026797 (1)
  • Ensembl_Trans:ENSDART00000017259 (1)
  • PROTEIN PRODUCTSNo links to external site
    ZEBRAFISH SUPPORTING SEQUENCES
    Type Accession # Length (bp/aa) Analysis
    RNA GenBank:AB195619 (1) 741bp
    GenBank:EB946602 (1) 622bp
    GenBank:EB949350 (1) 611bp
    GenBank:EB951285 (1) 605bp
    CITATIONS (2)