header logo image header logo text
Downloads Login
Research
General Information
ZIRC
ZFIN ID: ZDB-TSCRIPT-090929-9383
Transcript Name: cyp19a1b-001
Previous Name:

Add new Alias

Alias
Attribution

Attributions for Alias: {{control.newAlias}}

{{pub.zdbID}}

Delete Alias:

(Including Attributions)
Transcript Type: pseudogenic transcript
Annotation Status:
Strain: TU
Non Reference Strains:
Associated with Genes:
SEQUENCE
OTTDART00000026764 (1) [ Show ] (double-click sequence to select) [Download]
Select Analysis Tool
>tpe|OTTDART00000026764|OTTDARG00000021147|ZDB-GENE-001103-4 cyp19a1b|no_translation cyp19a1b-001 LG_ AL954697.15 Danio rerio unprocessed_pseudogene none, 4167 bp
AAGTTGGGGATGATGGAAGCCTGAGGACGGCAGGTCTGAG
CTGTATGTTCAGAAATGATTTAAAGAGGTGTGTCTGTATG
TGAGGTGATGATGGAGCATGTGGTAAAGGATGCGGTAAAC
ATCGGCGCTGTGGTGCAGGGAACATTACTGCTGCTGACGG
GAACCTTAATGCTGATTCTGCTGCACAGAATTTTTGGTGT
CAAGAATTGGAGGAATCAATCAGCTCTTCCAGGTCCCGGT
TGGTGGTTGGGTCTGGGGCCGGTTCTGAGTTACAGTCGGT
TCCTCTGGATGGGCATCGGCACGGCGTGCAACTACTACAA
TGAGAAATACGGCAGCATCGCTCGAGTTTGGATCAATGGA
GAAGAGACTGTTATACTAAGCAAGTCCTCCGCTGTGTACC
ATGTCCTGAAGAGCAATAATTACACAGGGAGGTTTGCCAG
TGCCAAAGGTCTGCAATGCATAGGTATGTTTGAACAAGGC
ATCATCTTCAACAGCAACATCGCAAAGTGGAAGAAAGTGA
GAACATACTTCACTAAAGCTCTTACAGGTCCAGGTCTCCA
GAAGTCAGTAGAGGTGTGTGTGAGCGCCACCAACAGACAG
CTTGACGTCCTGCAGGAGTTCACAGACGCCTCAGGACATG
TGGATGTGCTCAATCTCCTGCGCTGCATCGTGGTGGACGT
CTCCAACAGACTCTTCCTAAGAATCCCTCTCAATGAGAAA
GAGTTACTAATAAAGATCCACCGGTATTTCAGTACCTGGC
AGACGGTTCTCATACAGCCCGATATTTTCTTCAAACTGGA
CTTTGTGTACAGAAAATACCACCTGGCAGCAAAAGAGCTG
CAGGATGAAATGGGAAAGCTTGTGGAGCAAAAGCGACAGG
CCATCAATAACACAGAGAAGCTAGATGAAATGGACTTCGC
AACAGAGCTGATATTTGCTCAGAACCATGATGAGCTGTCT
GTGGACGACGTGAGGCAGTGTGTGCTGGAGATGGTGATCG
CTGCTCCAGACACGCTCTCCATCAGTCTGTTCTTCATGCT
TCTGCTGCTAAAGCAAAACTCTGCTGTGGAAGAGCAAATC
GTACAGGAGATACAGTCTCAGATAGGCTCGCGAGATGTAG
AGTCTGCTGACTTGCAGAAACTGAATGTTCTAGAGCGCTT
CATCAAAGAGTCCCTGAGGTACCATCCGGTGGTGGATTTC
ATCATGAGGCAGTCTCTGGAGGATGACTACATTGATGGCT
ACCGGGTGGCAAAGGGGACAAACCTAATCCTGAACATTGG
ACGCATGCATAAGACAGAGTTCTTCAAAAAACCCAACGAA
TTCAGCTTGGAGAACTTCGAGAACACTGTTCCCAGTCGTT
ACTTCCAGCCATTCGGTTGTGGTCCGCGGGCCTGTGTTGG
GAAGCACATTGCTATGGTGATGACGAAGGCCATCCTAGTA
ACCATGTTATCAAGGTTTACAGTTTGTCCTCGTCACGGCT
GCACCATCAGCACCATCAGACAGACCAACAACCTCTCCAT
GCAGCCAGTAGAAGAAGATCCCGACTGCCTGGCCATGCGC
TTCATCCCGCGAGCTCAAAACAGCAACGGAGAAACAGCGG
ACAACCGCACCTCAAAGGAATAAACATTTCAAGGCGCACA
GAGTAAATTCCTTGCACTTAACAAAGAGTTAAAGATCAAT
TGTTTTTCAATATGATGTTCAACTGAACTTACCTTAAACA
TAAAATTGTACTATTTAGATTTCTTCGACCAAGAGTCGAA
ATTATTCGCCAATTGATGTTTAGCAAAGCAAGGCATTTGT
CACAGTATTTTCTTGTAATATTTTTTCCTCTGGAGAAAGT
CTTATTTGTTTTATTTTGGCTAGAATAAAAGCAGCTTTTA
TTTAATTTTAAACCATTTTAAGGTCAATATTATTAGCCCC
CTTAAGCAATATTTGATTCAGATGGTCTACAAAACAAACC
ACTGTTATACAATGACTTGCTTAGTTACCAAAACTTGCCT
AATTAACCTAATTAAGCCTTTAAATGTCACTTTAAGTTGA
ATAATAGTATCTTAAAAACATCTACAAAAGAGTATGTACT
GTCATCATGGCAAAGATAAAACAGTTAAGTCATTAGAAAT
AAGTTATCAATTAAAACTATAGTTTAGAAATGCGCTGAAA
GAAATATTCGTTCCCTTAAACAAAAATTGAGGGAAAGTAT
ACAGGTGGCTAATAATTCTGACTTCAACCAAAGAGCTTAG
AATGACCAAGAGGCGACACTCAATAGAACGTTCCATTGCA
ACAGCAGCGCCCAGCAACAGCCCTGGATTTCGCCATTTTG
AAGTGAAAGTGATCGGCCGTCCATTGGATCTCATTACTTT
TGTGATGGCAAGCAGCTGCTTTGTTTTTTATGTATCTATT
TAAAAAGCATATTAAAGCTGAGATACAACCTGAAAGACGA
CAATACAACACTTACTATCACAATCATCAGCACTTTTAAT
AGTTTATTTTACAGACTAATAATATACTGTTATTCTATTG
GAGTTTTCATTCCAAAATGGCCGTCCTCTAGTGGCTGTTT
CCCAAATTACACTAGAGCGTCGCCTTTTGGTCATTCTAAG
CTCTTTGCTTCAACTCTATAATGACATTGAAGATTTTTAA
AGATGCACAAACTCAAAAACAAACACAAGCAACTAGTAGG
TAGTTAAACGTAGAGGGTTAAAAATGGCAAGAACAACTAA
ATACTGGGTAATCTGTTCTGTAACGTACTGATCAGTACTA
CCAAAGTGATTTTTGCTAGTAGACCATGTGGTGATGTCAT
TACACTCTTGAAAATTTCCTGCATGTTGTCAAACTAATAC
ATAACAAACAAGAGGTAAATCTATCCTAACTTATCGTTAA
AACAGCTATTATAATATTATGTATCAATATATGGACCTTT
TTATATTATCAGAAGCTGTAGTAATTAAGAAACAGAAAAT
GTTATTCAGGGTGTCCGTGGGGTCTTAAAAAGTATTAAAT
GTTGATCAATCAATTTAGAGAAATTTTTAAGGCCCTTAAA
AGGTAATAAAAGGTTTTTTTTTTTACAAGGTATTAAATTT
TGCATCATTTTTGATTCTACAATGTATAGTTGCATGCTAA
AGTTTGCCTGAATTTTATTGGAATGTTAGGCTGCTGTGTA
GTTTACGAAATGGATAAAATCCTGCAGTTCTGTAGATGCC
ACTTAGCGTTTTTATTCAGTATATGGATGTTTTAATTTAG
GATTAGTTTGTTGCAATCAGTATTTAGTAAATATACTGTG
TATTAAAATGTCGCAAATGTTACCGTGTGAAACCTAAAGT
GGCGATGAGGTCTTAACATGTATGGAAAGAGTCGTAAAAA
AGGTCTTGAAATGTCTCTTTGATTGCTGTATAAACTGTTA
ATGTTTACATCCCTCAAAATAGTCTACAGATGTAAAATCT
TGCATTTTATGATCTGTAATCTGTATTCAACTACAATGTC
AACTGATTTAACTTCCATGATGTGTTATATTTCTGAGATA
AACGGCAGGTTAATTGAGAAAACAGACAGTGAAAAATGAA
ATGAGTGGCTAACAATGAGGGAAGAGGACGTTGCTTTAAA
GGTTGGGCAAGTAACTTTTTAAAAAGTTTATGAAGGTGAA
TAACACCTTCCACAGCCATATCACCCTGCAGCCCAAGACT
GGTTACTCATGTAAGCTAAGCAGGGCTGAGCCTGGTCAGT
AACTGGATGGGAGACCACATGGGAAAACTAGGTTGCTGTT
GGAAGTGGTGTTAGTAAGGCCAGCAGGGGGCGCTAAACCT
GCAGTCTGTATGAGTCTTAATGCCCCAGTATAGTGAAGGG
GACACCATACTGTCAGTGAGCTCTGTCTTTCGGATAAGAT
GGTCCTGACTCTCTGTGGTCATGAAAAAAATCCCATGGCA
CTTCTCGTAAAGCGCAGTGGTGTAATTCTGGTGTCCTGGC
CAAACGGAACTAAATATTGTCAGTTTTTATGCGCTACAAA
AATAGTTTACAGTAGTTTACTGCTTGGGGTTGATTGTATC
ATGCATCTTTTATATTTTTTCTAACATTTAATTAGTATCA
AAACATGCTCTGATAATGTAAAAGTCTTCTAACAAAACTG
TTTAATAATTACATCAGCCAATAAAATGATCTGAAAATAA
TGCCAAA

SEGMENT (CLONE AND PROBE) RELATIONSHIPS
cyp19a1b-001 Contained in:

Genome Resources: Vega_Trans:OTTDART00000026764 (1)
PROTEIN PRODUCTS No links to external site
ZEBRAFISH SUPPORTING SEQUENCES
Type Accession # Length (bp/aa) Analysis
RNA GenBank:AF226619 (1) 3809 bp
GenBank:AF183908 (1) 2311 bp
CITATIONS (1)