ZFIN ID: ZDB-TSCRIPT-090929-9285
Transcript Name: dtnbp1a-003
Previous Name:

Add new Alias

Alias
Attribution

Attributions for Alias: {{control.newAlias}}

{{pub.zdbID}}

Delete Alias:

(Including Attributions)
Transcript Type: ncRNA
Annotation Status:
Strain: TU
Non Reference Strains:
Associated with Genes:
SEQUENCE
OTTDART00000026653 (1) [ Show ] (double-click sequence to select) [Download]
Select Analysis Tool
>tpe|OTTDART00000026653|OTTDARG00000021083|ZDB-GENE-040426-1036 dtnbp1a|no_translation dtnbp1-003 LG_ CR391941.10 Danio rerio protein_coding KNOWN, 804 bp
TGCGCATCTCGTGTCACTCGCAGTCGTATGAAGCGCACCC
ACTCTTGTGCCGCTCACACAAAAGAAGCGTTTCTTCATTC
TCTGCCAACTCGGCTAGAAGAACATCACGTTCTGTGCGGA
GCTCGATGCAGAACATGCCCAGAAAGTGCTGGAGATGGAG
CATGCGCAGCAGGTCAAGCTAAAGGAGCGGCAGAAGTACT
TTGAAGAGGCGTTTCAGCAAGACATGGAGCAGTACCTCTC
CACAGGATACCTGCAGATCACCGACAGGAGAGATCCATTA
GGCAGTATGTCCTCAATGGAGGTGAATGTTGACCTGCTGG
AGCAAATGGACCTGACAGATGTGTCTGACCACGAGGCTCT
GGATGTTTTCCTCAGCTCTGTAGGGGAAGAAAGCAGCGCT
GTGTCTCCCGATGCAGGAGGCCCTTCTCTAGAGCCCGGCT
CATCTCCATCTGACATCAGCCTGAAGGTGCCCTCACAGAG
CGAGCTCCGGCACAACATCTCCTCCATCTCCTCATCCTGC
ACCGACACCGTCAGCGGCACCACCGAAGGTCCAGACGAAG
AGGAGAGCAGCAGCGGAGACTCGCCACTTGTTCAGTCTGA
CGAGGAGGAGGTACATGCTGACACTGCCCTCATGGGCCTC
CCCGAAACAGAGGCGCTCAAAAGCTCAGACGACAGCGACA
CACAGGCCCCCTAGTGGCCACCCAGAGGAAACACAATCAG
TCCTGTTGCCTTTCTGGGGATGAAAACCTGCTTTACATCA
GGGTCCTGTGTGCTGAAGGCCAGCGGGACACTTTTTCATG
GCTG

dtnbp1a TRANSCRIPTS
Type Name Length (bp) Analysis
ncRNA dtnbp1a-003 804
dtnbp1a-004 (1) 785
dtnbp1a-005 (1) 538
dtnbp1a-008 (1) 421
mRNA dtnbp1a-201 (1) 2027
dtnbp1a-203 (1) 885
dtnbp1a-205 (1) 880
dtnbp1a-207 (1) 741
SEGMENT (CLONE AND PROBE) RELATIONSHIPS
dtnbp1a-003 Contained in:
OTHER dtnbp1a-003 TRANSCRIPT PAGES
  • Vega_Trans:OTTDART00000026653 (1)
  • PROTEIN PRODUCTSNo links to external site
    ZEBRAFISH SUPPORTING SEQUENCES
    Type Accession # Length (bp/aa) Analysis
    RNA GenBank:CK867360 (1) 930bp
    GenBank:DV592224 (1) 818bp
    CITATIONS (1)