header logo image header logo text
Downloads Login
Research
General Information
ZIRC
ZFIN ID: ZDB-TSCRIPT-090929-9247
Transcript Name: prss1-201
Previous Name: try-001

Add new Alias

Alias
Attribution

Attributions for Alias: {{control.newAlias}}

{{pub.zdbID}}

Delete Alias:

(Including Attributions)
Transcript Type: mRNA
Annotation Status:
Strain: TU
Non Reference Strains:
Associated with Genes:
SEQUENCE
OTTDART00000026613 (1) [ Show ] (double-click sequence to select) [Download]
Select Analysis Tool
>tpe|OTTDART00000026613|OTTDARG00000021061|ZDB-GENE-010131-7 try|OTTDARP00000021832 try-001 LG_ BX539313.4 Danio rerio protein_coding KNOWN, 871 bp
GCTTGGCGCTAAAAGCCAGAAAACACACCACTCAACAGCT
TCACCATGAAGGCTTTCATTCTTCTGGCTCTTTTCGCTGT
GGCTTATGCCGCTCCTCTGGGAGACGATGATGATAAGATT
GTTGGTGGATATGAGTGCACTAAGAATGGTGTTCCATACC
AGGTGTCTCTGAACAGCGGCTACCACTTCTGCGGTGGCTC
TCTGATCAGCAACCTCTGGGTTGTGTCTGCTGCTCACTGC
TACAAGTCCCGTGTCCAGGTGCGTCTGGGTGAGCACAACA
TTGACGTCACTGAGGGAACCGAGCAGTTCATCAACTCCGA
AAAAGTCATCAGACACCCCAGCTACAACAGCAACACCCTG
GACAATGACGTCATGCTGATCAAGCTGAGCAGCTCCGCCC
AAATCAACAGCTACGTTAAGACCGTCTCTCTGCCTTCAAG
CTGCGCTTCATCTGGAACCAGCTGTCTGATCTCTGGATGG
GGAAACATGAGCGCCAGTGGAAGCAATTACCCAAGCCGTC
TGATGTGCCTGAATGCTCCCATTTTGAGCGACAGCACCTG
CAGAAACGCCTACCCTGGTCAGATCTCCTCTAACATGTTC
TGCGCTGGTTTTATGGAGGGAGGCAAGGACTCCTGCCAGG
GTGACTCTGGTGGCCCAGTTGTGTGCAACAACCAGCTGCA
GGGTATCGTGTCCTGGGGTTATGGCTGTGCCCAGAGGAAC
AAGCCCGGTGTTTACGCCAAGGTCTGCAACTTCACCACCT
GGATCAGAAACACCATGAACTCCAACTAAGCTCGGGGAAG
TTTTGAGGTCGTTATCATGGCGTGTTGCAATACCATCTGG
CAAAGCAAAAATAAATGTCTGATAACAAACA

GBrowse:
SEGMENT (CLONE AND PROBE) RELATIONSHIPS
prss1-201 Contained in:
[BAC] DKEYP-84F3 (1)

Genome Resources: Vega_Trans:OTTDART00000026613 (1),  Ensembl_Trans:ENSDART00000077661 (1)
PROTEIN PRODUCTS No links to external site
ZEBRAFISH SUPPORTING SEQUENCES
Type Accession # Length (bp/aa) Analysis
RNA GenBank:BC092664 (1) 865 bp
GenBank:AF541952 (1) 845 bp
GenBank:CN322283 (1) 826 bp
CITATIONS (2)