header logo image header logo text
Downloads Login
Research
General Information
ZIRC
ZFIN ID: ZDB-TSCRIPT-090929-9220
Transcript Name: rb1-201
Previous Name: rb1-001

Add new Alias

Alias
Attribution

Attributions for Alias: {{control.newAlias}}

{{pub.zdbID}}

Delete Alias:

(Including Attributions)
Transcript Type: mRNA
Annotation Status:
Strain: TU
Non Reference Strains:
Associated with Genes:
SEQUENCE
OTTDART00000026573 (1) [ Show ] (double-click sequence to select) [Download]
Select Analysis Tool
>tpe|OTTDART00000026573|OTTDARG00000021029|ZDB-GENE-040428-1 rb1|OTTDARP00000047656 rb1-001 LG_ CU694531.8 Danio rerio protein_coding KNOWN, 3746 bp
TTCGCCAATTAGCAACGAGAGAGCTTAAAAATTCGTGTTT
ACAGTAGCACTGCGCTAAAATGTTGATTTGTTTGTCAAAG
CCTTTTCATTTCACTCACTGTTGTGTTGAGCGTTGACTAA
TGTATAGCCGGACATGACGCACGCCAAAGTGACGGATGTT
GCGTCGGTCGATTTTCCCGCGTTTTGACTAGTTGAGGAAA
TAGCGGAGAGTTGCGGACGCAAACAAGCGATCTCAGACAC
CGACTACCAACCACTAACCACAACAACACAAACATCACAA
CACAACTCGTGATCGCTCGCTGTGCTGAGAGTGAACGCGC
TCTTCTCCAAGAGACCCTCGACATGCCGCCGAAGAAGCGC
AGCAGCGGGACCCCACAGAAGAAAGAGCTGAAGGGGAGCC
TGAAGAGCCGATCTCCGGACAGCGGCGACAACGCAGTGCT
TAGTCCGGAACGACACAAGGACAAGGATCCTGAGTTTGTG
TTTCTCAGCGAGGAGCTCCAGTCCACTAACTCCATCTGTG
ATCATGCATGGAGAATATGGGAGAGGGAGATCAGATCGAT
GGACAAGACAAATATGCCGTATTCGAACAGACAGCAGTGG
GGAGCTTGTCTTTTTATTGCTGGCATGGAGCTTGAAGGCA
TCAACCTCACTTTTACGCAGTTCCTGAAAGCAGTTGGTCT
GAGTGTGAAGCAGTTCATCAGTCTTGTGAGGAAGATGGAT
GTAAATGTAGACACAATAAGTCCTAAAGTGAACTCTGCTG
TGACCCGCCTAGAGAACAAATACGATGTGACTTTGGCCCT
CTACCAAAGATTTGTAAAGACTTGTGAGAAAATCTTTGCA
GAGCCTGACAATGCAAAGAGAAAAGAGCTGTGGGAAAGCA
GCTGGACCATGTTCCTCCTGGCCAAGGGAACATTTCTGCA
GATGGAAGATGACCTTGTGATCTCCTTCCAGTTGCTGCTG
TGCGTTCTGGAGTTTTTCGCCAAGCGTTTGAGTCCGTCTC
TCCTTCAGTCGCCCTACAAGTCGGTGGTTAGTTCCTCTAC
CCTGAGTCCTCCGACCAGGACATCACGCCGTAATCAGGGC
AAAAGCAAACCCCGTCCTGCAGAGATGGACATGCAACTGC
TGGAGACGCTGTGCAAGGAGGGAGACTGCAGTGTTGATGA
GGTGAAAAACGTGTACCAGAGCACTTTCTGTGCCTTCCTG
GACTCTGTGGGTCTTTTAGGTCTCCAAGGGCTTCCTCCAA
TGGAAGCGCTTTCCAAGCAATATGAAGAGTTGTATCACAA
AAGCAAGGACTTTGATGCTAGGCTTTTCTTGTCTGACGAT
GAGACTCTTTCTCCCAATAAAATCGAAGTGTCAAAGGTAG
AAGTTACTCCAAGAAAGAATCTGTTTGCAGAGGACATTGC
AATTCCAGTTCCTCAAACTCCAATCAGGGCTGCGATGACC
TCCATACAGCAGCTCAGGGGTGACCTCACCTCAGGGAGTG
ACCAGCCTTCTAGCAATCTGCTGGTCTATTACAAGAACTG
CACTGTTGACCCATCTGGGGAGATCAAAAAGAGGGTTGAG
GAGCTTGGTGAGGTCTTCATCCAGAGGTTTGCTCAGGCTG
TTGGTCAGCACTGTGAGGGGCTCGGCAGAAAGCGTTTTTA
TCTTGGTGCTCAGCTCTACTACAAAGTAATGGAGTCCATG
CTTAAATCGGAGGAGAAGAGGTTATCAGTGCAGAACTTTA
GTAAACTTCTCAACAATGCAGCGTTTCATACATCATTGCT
TGCATGCGCTCTGGAGGTTGTTATAGCAACCTATGTTGGG
AGCTCCTTAAAGAATGGAGGTTTTGGCCGTAGTTCAGGGG
CCAGCGATTCCGTTGAAAGCGATCTGTGCTTTCCTTGGAT
TTTGAGTGTCTTCCAGCTGCCTGCTTTCGACTTTTACAAG
GTGATCGAGAGCTTCATTAAAGCCGAGCCCACCCTGAAAC
ATGACATGGTGAAGCACCTGGAGCAGTGCGAACATGTGAT
CATGGAGAGTCTTGCATGGAGAGCGGACTCTCCACTGTTT
GACCTGCTCAAACAGTCTCGCGAGGAAGGACCCGGTGAAC
AAGCAGAGCCCCCTGCAACACTCAACCAGCCCCTCCATCA
CAACCACACGGCTGCTGATCTGTATCTCTCTCCTGTCCGG
CCATGTCGTCAACCCCCTGTAATGGAGGCCGAGCCCCCCA
CACCAGGCACCAGAGCCCCCCGTTCAAACTCACTGAGCCT
TTTCTACAAGAAATTGTACAGGATGGCCTACCTGCGACTG
AAGATGCTGTTCTCCAATCTGCTGACCTCACATCCAGAAA
TGGAGCCAATAATATGGACTCTGCTTCAGCACACCCTCCA
GAACGAGTATGAATTAATGCGGGACAGACACTTAGATCAG
TTGATCATGTCAGCCATGTATGCCATATGCAAGGTGAAAA
ACGTGGATTTGCGCTTCAAAACTATTGTGACTGCTTACAA
AGAGCTGCCAAATACTAATCAAGAGACATTCAAGCGTGTG
CTGATCAGAGAGGGTCAATACGACTCCATCATCGTCTTCT
ACAACCTGGTGTTCATGCAGAAGCTGAAGACTAACATTCT
CCAGTATTCCTCTCCTCGGCCACCGCCTCTGTCTCCCATT
CCCCACATCCCCTGCAGCCCCTATAAAAACTCTCCCCTTC
GGGTTCCTGGCAGCAATAATGTTTACGTGTCTCCTCTGAA
AAGCAGCCGTGTGTCTCCTCTGGTCATGACCCCGCGGAGC
AGAATTCTTATATCCATTGGCGAATCCTTTGGGTCGGCAG
ACAAATTTCAGAAGATCAATCAGATGGTGAGCAGCTCTGA
CTGGTCACTCAAGAGGAGTCTGGATGGAGGCTCCGCCCCC
AAACCCCTGAAGAGGCTGCGCTTTGACATGGACGGACAAG
ATGAAGCAGACGGAAGCAAATCCAGTGGCGAGTCAGCACT
GATCCAGAAGCTGGCTGAGATGAGCTCGACACGTTCTCGA
ATGCAGGAACAGAAACTGAAAGAGGAGTCTGATAAAGATC
ATCCAGAGCCCTAAATAAATCCACACTGTACTGCTGAGGA
AAACCACTCCACCATCAAGCGGAAAGCCTGACGTCCCCTG
GTGTTTTATGTTACTACGTTTTAAACTCTTCCATTTTTTT
TTTGTATTTAAATGGTGCACTGCATTTCCTGAAACAGCAC
AGATGCTTTCCCTGCGTTGTTTCATTTTAGTTTGTTTTAA
GCATGCGTGGATCCATGAAGGATGTTTAGGAGTTGACGTG
AAACATACCTCTAAATTCATCTACAATAGTTTGCAAATGT
GCCGGGTTCAGTGTGTCATGGATATTTATTGTTTTGTTTC
TTTTAGAGCAACTTTTCCTCATTTCAGTACAGGAAAACCG
GGTTTGAGATCAATTTGAATCATGTATTTAGTAGATTTGA
ACCCTGTCTTTGTGGCCTTCTCGAAGCGTGTCACTATTTT
ATGTGATAAAAGGATTTTATTTAGAATTTGTATTATATAA
ATTTGTTGGTGTTTAAGCATTACTGGGTTTTAGAATATGA
TTGTTATGAATATGTCTGACTTATTACGTTCTTCCTGGGC
AGCGCTGCCGTTTTTTGGACTTGTTTTAGACTTTTTGTTA
CTAATATTCCTGAAAAAATTATGTTGTACATCAAATGTTC
TTTTTTTTTTTTTTTGACAAATTATGTATTTCTCCAAAAG
TTTAACAACTGACATGTTTGAAGAAA

GBrowse:
SEGMENT (CLONE AND PROBE) RELATIONSHIPS
rb1-201 Contained in:

OTHER rb1-201 TRANSCRIPT PAGES
  • Vega_Trans:OTTDART00000026573 (1)
  • Ensembl_Trans:ENSDART00000024309 (1)
  • PROTEIN PRODUCTS No links to external site
    ZEBRAFISH SUPPORTING SEQUENCES
    Type Accession # Length (bp/aa) Analysis
    RNA GenBank:AY125075 (1) 944 bp
    GenBank:CK028596 (1) 803 bp
    GenBank:AW422022 (1) 682 bp
    GenBank:CT701190 (1) 615 bp
    GenBank:EB924593 (1) 565 bp
    GenBank:EB775000 (1) 547 bp
    CITATIONS (2)