ZFIN ID: ZDB-TSCRIPT-090929-9132
Transcript Name: thoc3-201
Previous Name: thoc3-001

Add new Alias

Alias
Attribution

Attributions for Alias: {{control.newAlias}}

{{pub.zdbID}}

Delete Alias:

(Including Attributions)
Transcript Type: mRNA
Annotation Status:
Strain: TU
Non Reference Strains:
Associated with Genes:
SEQUENCE
OTTDART00000026458 (1) [ Show ] (double-click sequence to select) [Download]
Select Analysis Tool
>tpe|OTTDART00000026458|OTTDARG00000020964|ZDB-GENE-040808-14 thoc3|OTTDARP00000021701 thoc3-001 LG_ BX511257.16 Danio rerio protein_coding KNOWN, 1477 bp
CGAAGCAGAACTTCAAGCATGGCGTCCTCGTACTATCAGG
AGATGCAGGAGGTGTTCAGGAATAACAATAAAAGCAGAGA
GTTCCCGGCTCACAGTGCTAAAGTGCACTCGGTGGCCTGG
AGCTGTGATGGAAAACGACTGGCGTCCGGTTCGTTTGACA
AAACTGCCAGCGTATTTGTCCTGGAAAAAGACCGACTGGT
GAAGGAAAACAACTACCGTGGGCATGGAGACAGTGTGGAT
CAGCTGTGCTGGCATCCCACCAACCCTGATCTGTTCGTTA
CTGCATCAGGAGACAAGACCATCCGCATCTGGGATGTGCG
GACCACCAAATGCATGGCCACAGTCAGCACAAAAGGGGAG
AATATCAACATTTGCTGGAGTCCTGATGGTCAGACCATCG
CTGTAGGTAACAAGGATGATGTTGTAACGTTCATTGATGC
CAAAACACACCGTCCACGTGCTGAGGAGCAGTTCAAGTTT
GAGGTCAACGAAATCTCCTGGAATAATGACAATGACATGT
TCTTCCTGACCAACGGCAATGGATGCATCAATATATTAAG
TTACCCTGAACTGAAGCTCATCCAGTCAATTAATGCCCAT
CCATCCAACTGCATCTGCATTAAGTTTGATCCGACTGGGA
AGTATTTTGCCACTGGAAGTGCAGATGCCCTGGTCAGCCT
GTGGAACGTGGAGGAGCTGGTGTGTGTGCGATGCTTCTCA
AGACTGGACTGGCCTGTACGAACTCTTAGCTTCAGTCATG
ATGGTAAAATGCTGGCATCTGCATCAGAAGACCATTTCAT
TGACATAGCAGAAGTAGAGACAGGGGAGAAACTGTGGGAA
ATTCAGTGCGAGTCTCCAACCTTCACTGTAGCCTGGCATC
CGAAGAGGCCGCTGTTAGCATATGCCTGTGACGATAAAGA
GGGCAAATACGACAGCAACCGAGAAGCGGGCACCGTCAAA
CTCTTCGGCCTTCCCAATGATTCCTGAGGTCCGTTTACAC
ATATTAAGATAAAATTGAGATGTTATTCGAGCAAATTAAT
TTTCATTAGACTTATTGTTTTAAAGTAAATTTGTAAATAG
TTAAAAGATATTCTGATGTTCTGCTCTCATATTAGTTTTT
GGTTTAAAGTACAGGTGTAAATAACTACTGCCTGCAGCTC
CTCTGAATATGAGTTTTTATTTGTCTTTTACCAAAATATG
ACTGTGTGATAATACAAAAACAAAGTTTAATGTAGAATCT
GTGCAGAATACTTAAAAAAAATCTTGTGATTTAGTACAGC
ACGCTGTTCTTGTTTTCAATAATTGACCATTGCTGTTTTT
GAGAAAAATTGAGATAAAACTGTAATGCTAGTTTTAGAAA
TGACCAGCAGAGGGCATCACATGCTCAAAGAAAAGATGTC
TCATTGCTAATACAGGCATTTTTGAATGTGTGTTTGTTTT
TATAGCAATAAATTATGTACTTTATTTTTAAAATGAA

GBrowse:
SEGMENT (CLONE AND PROBE) RELATIONSHIPS
thoc3-201 Contained in:
OTHER thoc3-201 TRANSCRIPT PAGES
  • Vega_Trans:OTTDART00000026458 (1)
  • Ensembl_Trans:ENSDART00000079016 (1)
  • PROTEIN PRODUCTSNo links to external site
    ZEBRAFISH SUPPORTING SEQUENCES
    Type Accession # Length (bp/aa) Analysis
    RNA GenBank:BC079495 (1) 1510bp
    GenBank:DN771168 (1) 872bp
    GenBank:CK706434 (1) 863bp
    GenBank:CT702872 (1) 822bp
    GenBank:EB854005 (1) 695bp
    CITATIONS (2)