header logo image header logo text
Downloads Login
Research
General Information
ZIRC
ZFIN ID: ZDB-TSCRIPT-090929-9079
Transcript Name: mstnb-201
Previous Names: mstn-001, mstnb-001

Add new Alias

Alias
Attribution

Attributions for Alias: {{control.newAlias}}

{{pub.zdbID}}

Delete Alias:

(Including Attributions)
Transcript Type: mRNA
Annotation Status:
Strain: TU
Non Reference Strains:
Associated with Genes:
SEQUENCE
OTTDART00000026403 (1) [ Show ] (double-click sequence to select) [Download]
Select Analysis Tool
>tpe|OTTDART00000026403|OTTDARG00000020932|ZDB-GENE-990415-165 mstnb|OTTDARP00000021664 mstn-001 LG_ BX323586.10 Danio rerio protein_coding KNOWN, 2178 bp
ATCTACTTGTCCGGTGCGTGGTGAGGTTCATTTCCATAGC
AAATCAGAACATCAAACATCCTTTAGCACGCCTTGGAACA
TGCATTTTACACAGGTTTTAATTTCTCTAAGTGTATTAAT
TGCATGTGGTCCAGTGGGTTATGGAGATATAACGGCGCAC
CAGCAGCCTTCCACAGCCACGGAGGAAAGCGAGCAGTGTT
CCACATGTGAGTTCAGACAACACAGCAAGCTGATGAGACT
GCATGCCATCAAGTCCCAAATTCTTAGCAAACTCCGACTC
AAGCAGGCTCCAAACATCAGCCGGGACGTGGTCAAGCAGC
TGTTACCCAAAGCACCGCCTTTGCAACAACTTCTGGATCA
GTACGATGTTTTAGGAGATGACAGTAAGGATGGAGCTGTG
GAAGAGGACGATGAACATGCCACCACAGAAACCATCATGA
CCATGGCCACAGAACCTGACCCCATTGTTCAAGTAGATCG
GAAACCGAAGTGTTGCTTTTTCTCCTTCAGTCCGAAGATC
CAAGCGAACCGGATCGTAAGAGCGCAGCTCTGGGTTCATC
TGAGACCGGCGGAGGAGGCGACCACCGTCTTCTTACAGAT
ATCTCGGCTGATGCCCGTTAAGGACGGAGGAAGACACCGA
ATACGATCCCTGAAAATCGACGTGAACGCAGGAGTCACGT
CTTGGCAGAGTATAGACGTAAAGCAGGTGCTCACGGTGTG
GTTAAAACAACCGGAGACCAACCGAGGCATCGAGATTAAC
GCATATGACGCGAAGGGAAACGACTTGGCCGTCACTTCAA
CCGAGACTGGGGAGGATGGACTGCTCCCCTTTATGGAGGT
GAAAATATCAGAGGGCCCAAAACGAATCCGGAGGGACTCC
GGACTGGACTGCGATGAGAATTCCTCAGAGTCTCGCTGCT
GCAGGTACCCTCTCACTGTGGACTTCGAGGACTTTGGCTG
GGACTGGATTATTGCTCCAAAACGCTATAAGGCGAATTAC
TGTTCAGGAGAATGCGACTACATGTACCTGCAGAAGTATC
CCCACACCCATCTGGTGAACAAGGCCAGTCCGAGAGGAAC
GGCTGGGCCCTGCTGCACTCCCACCAAGATGTCTCCCATC
AACATGCTTTACTTTAACGGCAAAGAGCAGATCATCTACG
GCAAGATCCCTTCGATGGTAGTAGACCGCTGTGGCTGCTC
ATGAACCAGTGCCCAGACAGGACTTGATCCGTCTCAAAGA
CCCGGACATCTGATCACACCACCCACCATACATTACCAGT
GCTTTCCGCAAGACACTGTGCAATAGAAGGACGCTCACTC
ACTCTCTGGGCACCGCTTCATTTGACTATGTTATTTGTCA
TTTTCCTCTAAATCAGTATCTCTGCCACCAGGACTCCAAT
GTCAAATGGATGTATTAAAGGAATGTCATACTGTCTGGAC
TCGGGAATGGACAATATTGACAATGAATGGATGACATTCT
CTGCTTTATTTCATGTTTTCACCTTTCAGAATACTCTCAT
TAGGATGCGCAGACAACATACAAAGAAAAAATAAAATAAA
ATTGTATTACGCAACCACTCCAAAACACAATCATTTAGAT
CTTTGCTGTAACAGCTGTAACCGGTGAGCTTGTTTGACAA
GAGCATCCAAGAGAAACAGAGAGGGACTCTGGAACATTGA
ACTGAGCTTGAATACAGTTATCCAACGCAAACTTCAACAT
ACACCGCAATGAACACACAGATCAAATTGTTAATCGTAGG
TTTCGTCCACTACTCATCTGTCGAACAGCCCAACACACTT
GAAGCATTACTGAGATCGGCATAAGGGGACAGAAGGACTT
GAAGCAGAGGCACTGTGAATGCGGTTTACACATTGACATG
TGTTCAAGACAGAGACATCGGAACTGTATGAATGAATGTT
ACTATCACGCTAACACTCTGTCTTCAAACCACACAGTTTG
CACTATGGCAGACCAATAGAAAGAATTGGTTGCTAAAAAT
GTTGTAAAAACTGATTTTGATATGTTTGCTAATTGTATTG
TATACTTGCCATTGTTTCCATTAACAGTTGCCTTTTTTAA
CCACAGTTAGTACATGTATAAGAACACAAAATAGCAACAA
AAAAAAGTGTACAATATAAATCTATGTATCTGTTCAAACA
AATAAAGGTGCTTGCTTT

GBrowse:
SEGMENT (CLONE AND PROBE) RELATIONSHIPS
mstnb-201 Contained in:
OTHER mstnb-201 TRANSCRIPT PAGES
  • Vega_Trans:OTTDART00000026403 (1)
  • Ensembl_Trans:ENSDART00000100386 (1)
  • PROTEIN PRODUCTSNo links to external site
    ZEBRAFISH SUPPORTING SEQUENCES
    Type Accession # Length (bp/aa) Analysis
    RNA GenBank:AF540956 (1) 2179bp
    GenBank:AY258034 (1) 1500bp
    CITATIONS (2)