ZFIN ID: ZDB-TSCRIPT-090929-9054
Transcript Name: mlh1-002
Previous Name:

Add new Alias

Alias
Attribution

Attributions for Alias: {{control.newAlias}}

{{pub.zdbID}}

Delete Alias:

(Including Attributions)
Transcript Type: mRNA
Annotation Status:
Strain: TU
Non Reference Strains:
Associated with Genes:
SEQUENCE
OTTDART00000026377 (1) [ Show ] (double-click sequence to select) [Download]
Select Analysis Tool
>tpe|OTTDART00000026377|OTTDARG00000020917|ZDB-GENE-040426-1600 mlh1|OTTDARP00000021645 mlh1-002 LG_ BX936318.10 Danio rerio protein_coding KNOWN, 778 bp
ATTCGCGCCTGAACTTCTGCGGGTGTGCTGTAGGACGTAA
ACAAACCTTCACGTGTTTTGGCTTTGCAATATTTTCTATT
CTACAATTGTGAATCCGTCTGAGTGTTTCTTTGTGATCTA
GTGAATGAGTTGATGATGGCGGGAGTCATCCGCAGACTCG
ACGAGACTGTAGTGAACCGCATCGCAGCCGGAGAGATTAT
CCAGCGGCCTGCCAATGCTATCAAAGAGATGATGGAGAAC
TGTTTGGATGCAAAGTCTACGAACATCCAGATAACAGTGA
AAGAGGGCGGACTGAAACTCATCCTTATTCAGGACAATGG
CACTGGAATTAGAAAAGATGATATGGAAATAGTCTGTGAG
CGTTTTACGACCAGCAAGCTGCAGTCTTTTGAAGATTTGT
CATCCATCGCAACATACGGATTCAGAGGAGAAGCCCTCGC
CAGTATAAGTCATGTAGCTCACGTCACCATCACCACAAAA
ACAGCAGATGCTAAATGTGCTTACAGGGCCAATTACTGTG
ATGGGAAACTAAAATCTCCACCCAAACCCTGTGCTGGAAA
CCAGGGGACACTGATTTCTGTAGAGGATCTGTTTTATAAT
GTGTCTACGCGACGGAAAGCCCTAAAGAGCCCCAGTGAGG
AATATTCCAGAATCGTCGAGGTTGTGAGCAGATACGCCAT
TCACAACTCTGGGAAAAGTTTTTCTGTCAAGAAGCAAGGT
GAGATGGTTGCAGATGTGAAGACTCTCCCAAACGCCTCTG
TGCTGGACAACATCCGTG

mlh1 TRANSCRIPTS
Type Name Length (bp) Analysis
mRNA mlh1-001 (1) 2318
mlh1-002 778
SEGMENT (CLONE AND PROBE) RELATIONSHIPS
mlh1-002 Contained in:
OTHER mlh1-002 TRANSCRIPT PAGES
  • Vega_Trans:OTTDART00000026377 (1)
  • PROTEIN PRODUCTSNo links to external site
    ZEBRAFISH SUPPORTING SEQUENCES
    Type Accession # Length (bp/aa) Analysis
    RNA GenBank:CO797167 (1) 871bp
    GenBank:DT878137 (1) 790bp
    GenBank:CK696680 (1) 765bp
    GenBank:AI558727 (1) 745bp
    GenBank:EB912030 (1) 346bp
    CITATIONS (1)