ZFIN ID: ZDB-TSCRIPT-090929-9025
Transcript Name: ddx18-001
Previous Name:

Add new Alias

Alias
Attribution

Attributions for Alias: {{control.newAlias}}

{{pub.zdbID}}

Delete Alias:

(Including Attributions)
Transcript Type: mRNA
Annotation Status:
Strain: TU
Non Reference Strains:
Associated with Genes:
SEQUENCE
OTTDART00000026348 (1) [ Show ] (double-click sequence to select) [Download]
Select Analysis Tool
>tpe|OTTDART00000026348|OTTDARG00000020904|ZDB-GENE-030131-9685 ddx18|OTTDARP00000021627 ddx18-001 LG_ BX001051.29 Danio rerio protein_coding KNOWN, 2780 bp
ACTGTGTACGGGTTAGGTCAGCTCTGCTGACTGACAAATA
TTATTACTTATATATTGAAGCATTTTGGCAACCTAGTTTT
GCAGGTACTCACTAATAAAGAAGGTTTCTAACATGTTTTT
GTTTATTTATTTATTTTAATCTTTTTTATTTATCAGACTT
ATTTGGTTCCTATGAGGGGAAAACAGCTAGTAAATAATAC
AGAATTAGGAAATGTAAAGAAACGTCTTGAAACACATAAA
CACTCGTAATGTAAGGTTTAGAGCCAAAAACTACATTTTA
CTAAGCTAAAATTGCGGTTAATTTTTGTCGGAAATATAAG
ATGTTAACTTGTTGTAAAATCGTTAAAAGGGTGCACATTT
ATTGTTTGTTTGTTCCATACAGAAAAAAATACAGCTGTCG
CATCTCTGACAGTAAATAAATGATTAAAATTCGAGCCTAA
TTCGCAAAAAAATATTAAACATTTTTATGTAAAGTATAGG
TCGCCGCTGGCAACAACCGAGCCGCACGATTTATGTATAT
TTAAATGCCTTAAACATTTTAAGTCAGGCAAAAATTGAGT
CAGTCTGCAGAGTGAAGGACCCCACGCAGCACGCGCACAC
GTGTTTGTCTACAGCCATGGCGGACATGCAGATGAAGATT
CTTCGCAAGAAAATTCAAAAGATAAGCGAAAAAAATAAAC
AACGCAAACTGCTGCAATCTCAGAAAGAAGAAGAAAACAG
CGAAGACGTGAAGGATGTTTTGGATGAATCTGAAGTGGCC
AGTGATTCTGCTCCAAATGTCATCGAAGAGCAGCAGCAAA
GTGTCTCGGATGAAGTGAACGAAACCTCACAGAAACCCAA
GAAGAAGAAAAAAAAACGAAAATTAGATACTACTGGAGAA
TCAACAACATCCAGTGTAAAAAAGGCTAAAAAGCAGAGTG
TAGAGACAACACAGGCATCTGCAGGTGAGGAAGAGCAGCA
GGAAGAAGGAAATTTAGAGACTGTGAAGTGTCCAGAGAAT
GGAAATAATGAAAAAGAGGGATCGGCTGAGGAGGATAGTG
ATGAAGATGGACCACAACTTCCTTCTGGTCTGACAGGTGC
GTTTGAGGACCGGTCATTTGCATCCTTGTCAGAAGTGGTC
AGTGAGAACACGCTGAAGGGAGTGAAGGAAATGGGCTTTG
ACACCATGACTGAAATCCAGCACAAGACCATACGCCCTTT
GCTGGAGGGAAGAGACGTGTTGGCAGCAGCTAAAACAGGA
AGTGGCAAAACTCTAGCTTTCCTGATTCCCTCAATTGAGC
TTATCTATAAACTGAAATTCATGCCTAGAAATGGCACTGG
AGTGATAGTTCTGTCTCCTACACGTGAGTTGGCTATGCAG
ACGTACGGCGTGCTGAAGGAGTTGATGACCCATCACGTCC
ACACATACGGCCTCATCATGGGTGGCAGCAATCGCTCTGC
TGAAGCCCAGAAACTCGCTAATGGAGTTAATATCTTGGTA
GCAACACCTGGCAGACTTCTGGATCACCTGCAGAACACTC
CTGGCTTCATGTTTAAAAACCTTCAGTGTCTGATCATCGA
TGAGGCTGACAGGATTCTGGAGGTGGGATTTGAAGAAGAA
CTGAAACAGATCATCAAACTACTTCCTAAAAAAAGACAGT
CTATGTTGTTTTCTGCAACACAAACACGTAAGGTGGAAGA
TCTTGCACGGATCTCCCTTAAGAAGGAGCCGCTGTATGTG
GGAGTGGACGATAATAAAGACACAGCCACTGTTGAAGGAC
TAGAACAGGGATATGTTGTGTGTCCTTCGGAGAAGCGTTT
CCTGCTGCTGTTCACGTTTCTGAAGAAGAATCGCAAGAAG
AAGCTGATGGTGTTTTTCTCATCCTGCATGTCGGTGAAGT
TCCACTATGAGCTGCTCAATTACATCGATCTGCCCGTCAT
GGCTATTCATGGGAAGCAGAAACAGACAAAGAGAACCACA
ACGTTTTTCCAGTTTTGTAATGCAGATTCTGGCATTCTCC
TCTGTACGGATGTGGCTGCCAGAGGTTTGGATATCCCCGA
AGTGGACTGGATTGTTCAATTTGACCCACCTGATGATCCT
AAGGAGTACATCCATCGTGTTGGGCGAACAGCTCGTGGTA
TTAATGGAAGAGGACATGCACTGCTGATCCTGAGGCCAGA
GGAGCTTGGCTTTTTACGATTCCTCAAGCAGGCCAAAGTT
CCCCTGAGTGAGTTTGAATTCTCCTGGACAAAAATCTCAG
ATATTCAATCTCAGTTGGATAAACTGATCGAGAAAAACTA
CTACCTTCACAAATCAGCTCAGGAGGCCTACAAATCCTAT
GTCAGAGCTTATGATTCTCATTCCCTTAAGCAGATCTATA
ATGTAGAGACGCTGGACCTCCCGAAAGTGGCAATGTCCTT
TGGATTTAAAGTGCCACCTTTTGTGGACCTCAATGTTCAC
AGCAGTAAAGGAGTGAAGCTACATAAGAGAGGTGGAGGCG
GCGGCTTCGGATACCAGAAATCTAAAAACGTCCACAAGGC
CAAGATCTTCAAACATGTCAACAAAGGCAAGGGAGACGGC
AGACAGTTTTCACGCTGAGAATAATTTCCAGATATGCACC
TCTTTCAGTTTATATGGAGTAACTGTCGGGCTACCTCAGT
TGTGTGAGAGGAGCTCTGATCAGTCCGCATTCCATGTCTG
TACAGAAATCTGTTTTCAGAGGCTGTTATATTGTTATATG
ATGCTGAATTTCTATTGTTACTGGCCTTATTAAACATGCA
GATGTATGCTATGAATAGTT

GBrowse:
SEGMENT (CLONE AND PROBE) RELATIONSHIPS
ddx18-001 Contained in:
[BAC] DKEYP-68F9 (1)
OTHER ddx18-001 TRANSCRIPT PAGES
  • Vega_Trans:OTTDART00000026348 (1)
  • PROTEIN PRODUCTSNo links to external site
    ZEBRAFISH SUPPORTING SEQUENCES
    Type Accession # Length (bp/aa) Analysis
    RNA GenBank:BC096848 (1) 2235bp
    GenBank:AY648748 (1) 2167bp
    GenBank:EH536440 (1) 872bp
    GenBank:CT708954 (1) 765bp
    GenBank:DT866035 (1) 711bp
    CITATIONS (1)