ZFIN ID: ZDB-TSCRIPT-090929-8957
Transcript Name: asmtl-001
Previous Name:

Add new Alias

Alias
Attribution

Attributions for Alias: {{control.newAlias}}

{{pub.zdbID}}

Delete Alias:

(Including Attributions)
Transcript Type: mRNA
Annotation Status:
Strain: TU
Non Reference Strains:
Associated with Genes: asmtl (1)
SEQUENCE
OTTDART00000026274 (1) [ Show ] (double-click sequence to select) [Download]
Select Analysis Tool
>tpe|OTTDART00000026274|OTTDARG00000020864|ZDB-GENE-030131-2854 asmtl|OTTDARP00000021573 asmtl-001 LG_ BX601644.6 Danio rerio protein_coding KNOWN, 2164 bp
CTCTTCAGGGTCTCGGCAGTGGACAGCGTTTCGAAAAGCC
CAGAGAGAGAAGTGGAACAAGCTTTTACAGGAAAGAGGTG
GAAGTGACAGAATCATGCCGTTAAATCCAGTGATATCCAA
GCTAAGTGGAAAGCTGGTTGTTCTGGCAAGCGCATCTCCA
CGACGCCTGGAGATTTTATCAAATGCTGGTTTACGATTTG
AAGTTGTTCCCTCCTGGTTTAAAGAAACACTGGACAAGTC
CTTGTTTAAGCACCCATGTGAATATGCAGTGGAGACAGCT
AAACAGAAGGCTTTGGAGGTGGCTCAACGAATGCCATTTA
AACACTTGAAAACTCCAGATATTGTTATCGGAGCGGACAC
TGTTGTGACTGTTGATGGCTTGATCTTGGAGAAGCCTACA
GATAAACAAGATGCTTACCGTATGCTGTCCAGGTTGAGCG
GGAAGGAACATAGTGTCTTTACAGGTGTAGCGATCGTGAT
CTGCCGTGACAAAAATAGTTCAGTAACAGATTACAAAGTG
GTTGATTTTTACGAAGAGACAAAAGTGAAGTTTGCAGAAT
TATCTGAGGAGATGCTTTGGGAATATATCAACAGTGGAGA
GCCCATGGACAAGGCCGGTGGTTATGGTATTCAAGCTTTG
GGTGGCATGTTGGTGGAATATGTGCGAGGAGATTTTCTCA
ATGTAGTCGGCTTTCCTCTTAACCACTTCTGCAAGCAGTT
GGGATCGATTTTCAATAGTCCACCTGCAAGTCCTGCCCAC
AAAATCAAACGGGACTGCGATGAAGCTTGGACTCTTGTTA
ACAAGACCACCAATGGGGATGTTGAGCTACTAGAAAATGT
TAAAGATGACAGTTTGACATCTGTGCAAGAACAGAATGTA
ATGGGATTAGAGTTTGCCAAGTGCAACAGACAGGACGTCC
CCCACAGCATCATCAGCTTGCTGGATGGGTTCAAAGTATC
AAAGACTCTATTCACAGCATCCAAACTGAAGGTGTTCGAT
GTATTAAACACCCCTGGTGGTCTAACATTGGAAGAGGTAG
CTGGCCAGATCAACGCTTCTCTTTTAGGCACTGAAAGGCT
TCTGGAAGCCGCTGTCTCCTTAGGCCTACTAGAAAGGGTC
AGACAGGAAGAGATCAGTGTGTACAGAAATACAGAACAGG
CCAGTCGTTTCTTGGTAACGGACAGCCCAGTGTCTCTGCA
TGGATATATTCTCCACTGCAATGATATGGTGTGGCCTCTG
TTCAGTCATCTAGAGAGCGCTGTAAGGGAGGGCACCAGCC
AACATGAGCGGGCCTTTGGAAAGAAGAAAGAAGACGTGTT
TCAGGATGTTTATTACAGTAAAGATGAAGTTAAGATACGG
TTCATGGATGCAATGCACAGCATCGCAAGAGTGACTGGAA
AAGATCTGGCAACCGCATTCGATCTCTCATGCTACAAAAC
AGCTTGTGATATCGGAGGTTGCACTGGTGCCATGGCATAC
GAGTTTACAAAAGCACACCCTGAGTTGTCAGTTACTATAT
TTGACTTGCCACAAGTCATCGAGATGAGACGTCATTTCCA
GCCGAAAGAAAATGATGAAAGAGTGTCATTTGTTGCAGGA
GATTTCTTTAAAGATGACCTACCTAAAGCAGACCTGTATA
TTCTTGCACGGGTCCTCCATGACTGGTCTGATGAGAAACT
GCATGTGTTATTGAGTAAACTGTCTAAAATGTGGACACCA
GGTTGTGGGCTCCTGGTTTCTGAGATCCTCCTGGACGAGG
AGCGGAGAAGGCCGAGTCGAGCCCTGCTTCAGGCCCTCAG
TATGACAGAAGGAAAGCAGAGGAGCACAGCAGAATATAGT
GCCTTACTGGACAAGCACGGCTTCACTCTTAAACATGTCA
AACACACGGACAACCTGCTGGATGCCATGCTATTTGTGAA
AGAAGAACAGAATGACAAAAGAACATTATTAGGCTGTTCT
TCAGCTTCCATTGAAACCGCAGAACTTGAGTAAAGTCATT
TCTACAGCATCTGCATTGGAAACACTACAGCTGACTTCCA
TTGAGTGCAATAAATGTATTAGCTGTGTGTGTTTTTTAAA
TAATTTGAATATTTGTAGATGATCATTGCTAATTAATGTG
TTCAACTGTTATAGAATGCATTAAATATGGTTTTGAATCA
AATA

asmtl TRANSCRIPTS
Type Name Length (bp) Analysis
mRNA asmtl-001 2164
ncRNA asmtl-002 (1) 547
SEGMENT (CLONE AND PROBE) RELATIONSHIPS
asmtl-001 Contained in:
OTHER asmtl-001 TRANSCRIPT PAGES
  • Vega_Trans:OTTDART00000026274 (1)
  • Ensembl_Trans:ENSDART00000011163 (1)
  • PROTEIN PRODUCTSNo links to external site
    ZEBRAFISH SUPPORTING SEQUENCES
    Type Accession # Length (bp/aa) Analysis
    RNA GenBank:BC055218 (1) 2159bp
    GenBank:CT692684 (1) 695bp
    GenBank:CK685419 (1) 594bp
    CITATIONS (2)