header logo image header logo text
Downloads Login
Research
General Information
ZIRC
ZFIN ID: ZDB-TSCRIPT-090929-8896
Transcript Name: usp16-201
Previous Name: usp16-001

Add new Alias

Alias
Attribution

Attributions for Alias: {{control.newAlias}}

{{pub.zdbID}}

Delete Alias:

(Including Attributions)
Transcript Type: mRNA
Annotation Status:
Strain: TU
Non Reference Strains:
Associated with Genes:
SEQUENCE
OTTDART00000026204 (1) [ Show ] (double-click sequence to select) [Download]
Select Analysis Tool
>tpe|OTTDART00000026204|OTTDARG00000020827|ZDB-GENE-030131-4153 usp16|OTTDARP00000021522 usp16-001 LG_ CR854897.8 Danio rerio protein_coding KNOWN, 3660 bp
AGAGCAGTCGGTGAACATGCTGTACGCTGTTGCTTTTAAT
GCTGTAAATTTCACCACAAAATGATTAAATTACTGCTACT
TGAATGGATGTAATTCAGTTTATCATGTTTTAAAGGTTTT
CAGGAACTGCTGTTTGAAGTGAAATGGGAAAGAAGAAGGT
AAAGGACAGAAGTGCTGGAACAGACAGCAGCTCTGAGACT
GCAGGGCCCTCCTGCACTCACATTCGTAAAGGAACAGAGA
ACAGCGTACTGAAGAAAGCCTGTCTGAATGAGCACTGGAG
CTCCTGTCAAGACTGTGAGCAGGACAAGCCTGAAGAAAAG
CAGATCTTAGAGGATCAGACTGACGGAGAGAGTCCAGCTG
TGTGGATGTGTCTGAAATGTGGACACAGAGGATGCGGGAG
ATCAGGGAATCAGCACGCTATCAAGCACTACGAGACCCCT
CGCTCTGAGCCACACTGTTTAGTTCTCAGCCTGGACGTCT
GGAGTGTCTGGTGTTACATCTGTGATGATGAAGTGCAGTA
TTCCAGCACAGGGCAGCTGGCACAGCTGATCACTAATATC
AGAAAACAAGTGCTGACGGCTCCTGACAAGAGGAATGCCA
GCAAAAAAAGTTGGAAAGAAGACATCTCTGTGATGAATTC
TGCAGAGCAAACGCAGGATGAAGAGAAAGGGAAGAAGGGG
AAGCAGAAGAGCAGCTCGAAACAAGAGGACAGTCCTAAAA
GCCATCAATCAGCCGCCGCTGGAAGCTCAGCTGTGGTGTC
TGTCAGGGGTCTCAGTAATCTGGGAAACACGTGTTTCTTC
AATGCAGTCGTGCAGAGTTTATCACAGACACAGTATTTGA
GGGAGCTGCTGAAGCAGATTGCAGAGGAGAAGAGCAGCTT
CTCCATCACTCCAGCACTGTCATCTGAGCTGGATCCTCTT
CAGATCCAGCTGGAAAGGCCTGGATCGCTCACTCTGGCTA
TGTGTCAGCTAATGAATGAAATCCAAGAGACCAAGAAAGG
TGTTGTGACTCCTAAAGAGCTCTTCACACAAGTGTGTAAA
AAAGCTCCACGTTTTAAAGGCTTTCAGCAGCAGGACAGTC
AAGAGCTTCTGCGGTACCTTCTGGATGGCATGAGAGCTGA
AGAAGCGAAAAGAGTAAATTCAGGAATTCTGGAGGCTTTA
AAATCTTCTGGCAAAAACTTTGAGGCTGAGCAGACGAAGA
AGATCGTTAAAGAGTATGAGAAAGACGGAGCGCCCAAGAA
CTTTGTGGACCGAGTGTTTGGTGGAGCGATGAGCAGCACA
GTGATGTGTAAAGAGTGCAAAACTGTATCCCTGGTCACTG
AGATGTTTCTGGATCTTTCTCTTCCTGTAGCCGATGAGGC
CTACAGGAAGAAGAATCAGAAGAAAGCAGTCCAGCATCGA
CACAGTGTCAGTGATGATGGAGACCAAGACACAAGTTCTC
TAGCCAATGGGAATGAAGACATGCCTACAGGAACAGGAAG
CAAATATCAGCAGAAGAAAGCCAAAAAACAGGCCAAGAAA
CAAGCCAAGAATCAGAGACGGCAGCAGAAACAGGGCGGTA
AAGTCACCCTAGATGCCATAACCAATCAGAGCTCAACAGA
TCCAGCAGACAGTTCCATGCAGACTCAGACGGTCTCCGTA
AACGGCAGCGCTGATGCACAACCAGCAGACACCAACCAAG
AGGATTTGAGCCTCGAGAAACACAACGAGGATCAAGATGA
TGAGGAACCAGAGCAAGAACAAGCTGCTTCAGTGAACAAC
CGCTTCACTGCATTATCTGAAGACCAGACAACTGAAGATA
TAGCAGAACAAGTGAATGAAGATGAAGATGAAATTGAGCA
GAATTGTGCTGAAGAGGAAGAGCTAGTAGAAGAACTGAAT
ACAATGTCTCTGACAACACCATCAGAAGGTGATGTAGAAA
ATGGAGAAGACACCTTGGAGGATGTTAAAGAGTATACCGT
GGTAAATCGGGACCCTGAGCTGGCATTTCGAGCACTGGCC
TCCAGGACGGCACCAGTGAAGCAGGAGTGTTCAGTGGAGT
CCTGCCTGTATCAGTTCACTGAGGTGGAGCATCTGACTGA
GAACAACAGACTGATGTGTGTTACATGCACTAAACAACAG
CCGGGATATAAAGATGGTTGTAAGAAGGCTGTTTACAGAG
ATGCACTGAAGCAGATGCTGATCTCTGATCCTCCAGTGGT
GCTCACCCTCCACCTGAAGAGATTCCAGCAGGTTGCATAC
AGTGTTTGTAAGGTCAACAGACACGTGCAGTTTCCTCAGA
TCCTGGATCTCGCTCCATTCTGCTCTTTAAACTGCACGGG
TGTAAAAGAGGGCGAGACGCAGGTGCTGTACAGTCTCTAT
GGCATAGTGGAACACAGTGGCACCATGCGCTCTGGACACT
ACACTGCCTATGTTAAATCACGACCCTCCACACACAATTG
TGTACAAAACGGGACTGCTGCTGCATCAGGTGACGCCGAG
GCCAGTAAAGGATCCTGGTTTCACATCAGCGACAGCAGCG
TCCATCCGGTTCCAGAGGCCAAAGTACAGAGTTCCCAAGC
CTACCTCTTATTCTACGAGAAGATCTCATAAAGCTTTGCT
AAAACGAGCTACGATCCATACAAAGGGCTGCTGGTGCTTC
ATTCTGACTGCTGGGAAATCTACATAAAACAATGCAAACA
ACTGGAAACTTGACATCATGTTATTTGTTTATCAGCTCTT
ATTCAGGGGAAACTTTTAATACATCTAAACCAGTGATTCC
CAACCCTGTTCCTGAAGACACACCAATAGTGCACATTTTC
AACCTCTCCCCTACTAAATGGCATCCAAAATATGTACTGT
TGGTGTGCCTCTAGGAACAGGGTTGGGAAACACTGATCAA
AGTGACATGCAGAACCTAATTGTGATCATTAGGATTTTTT
AAAGTTAATAAGGCTCATTTGTGATTTGAAAGTGATTAAT
TGTTCATATTTCCTACCTCTAGGTCTTGATAATACAGTCT
GAAGAGGCTTTGTTGTGGTGCATTTCTCAACATTTATCTC
CATATGCTATATGGCAGTGTTTCTCAACCACGTTCCTGGA
GGCCCATCAACACTGCATGTTTTGGATGTCTCCTTTGTCT
GTCACACCCATTACATGTCTTTCAGTCTCTGCTAATGAGG
AGATGATCTGAATCAGGTGTGTTTGGTAAAGGAGACATGG
AAAATGTGCAAAGATGGTGATCCTCCACGAACGTGGTTGA
GAAACACTGCTATATAGGACTTTGTTGTCAAGTCTGGGAG
TCCTTTGAATCAATTAGAGTCAATTTTCACCTCAAAATGA
TGATAATTAAGCACATTTTCCAACAATGTTCATTGCTCTT
ATGCAAATAATCTTTTATTAATATGAATTTAATGCTGCAA
ATTATCATGGACACATTTTTAATAATTATATTATGTAAAC
ACAAACAATGCCAAGTGAATTTGAGTTTAGAAATGCAAAT
AAACATTAGGTTAAATAATAAAAGGTAAATGTACTTTTTG
TTTAATTTTGGGAAGAAATATGAACATAAATATGACCAAT
ACATCCATTTAAATTTCTAAAAATGTCTAAAATGTATGTA
TTTTTCCTCCAGAATATCGTTACAACTTTATATTGCAATA
AATATCTTGTCCTCATATAA

usp16 TRANSCRIPTS
Type Name Length (nt) Analysis
mRNA usp16-201 3660
usp16-202 (1)    Ensembl 746
usp16-203 (1)    Ensembl 488
SEGMENT (CLONE AND PROBE) RELATIONSHIPS
usp16-201 Contained in:
[BAC] DKEY-121N8 (1) (order this)

Genome Resources: Vega_Trans:OTTDART00000026204 (1),  Ensembl_Trans:ENSDART00000085645 (1)
PROTEIN PRODUCTS No links to external site
ZEBRAFISH SUPPORTING SEQUENCES
Type Accession # Length (bp/aa) Analysis
RNA GenBank:EE696439 (1) 938 bp
GenBank:DV589590 (1) 791 bp
GenBank:DN856938 (1) 771 bp
GenBank:CT673645 (1) 706 bp
GenBank:AI931014 (1) 597 bp
GenBank:EB931739 (1) 482 bp
GenBank:EB784381 (1) 480 bp
GenBank:EB871420 (1) 473 bp
GenBank:CK695492 (1) 467 bp
GenBank:CT585094 (1) 390 bp
GenBank:CT589976 (1) 390 bp
GenBank:CT589975 (1) 372 bp
CITATIONS (2)