header logo image header logo text
Downloads Login
Research
General Information
ZIRC
ZFIN ID: ZDB-TSCRIPT-090929-8811
Transcript Name: unc5b-201
Previous Name: unc5b-001

Add new Alias

Alias
Attribution

Attributions for Alias: {{control.newAlias}}

{{pub.zdbID}}

Delete Alias:

(Including Attributions)
Transcript Type: mRNA
Annotation Status:
Strain: TU
Non Reference Strains:
Associated with Genes:
SEQUENCE
OTTDART00000026118 (1) [ Show ] (double-click sequence to select) [Download]
Select Analysis Tool
>tpe|OTTDART00000026118|OTTDARG00000020769|ZDB-GENE-041213-1 unc5b|OTTDARP00000021450 unc5b-001 LG_ CR456683.7 Danio rerio protein_coding KNOWN, 2735 bp
ATGGCAGCGATTACAGTGAAGTTCTCCCGGACTCGTTTCC
ATCAGCTCCTGCCGAACCGCTGCCAGAATTCCAGAGTGAG
CCCGAGGATGCATTCATAGTAAAAAACAGACCCGTCAAAC
TGTCCTGCAAGGCCGCCCCTGCCACACAGATATACTTTAA
ATGCAATGGAGAATGGGTGAACCAGAATGACCATGTGACC
AAGGAAAGTCTGGACCATATCACAGGTCTGGTAGTGAGAG
AAGTAGATATCTCTGTCTCCCGGACGCAGGTAGAGGAGTT
GTTTGGGCTGGAGGATTATTGGTGCCAGTGTGTTGCCTGG
AGCTCGGCAGGCACCACAAAGAGCCGTCGGGCTTACGTCC
GCATCGCCTACTTGAGAAAGAACTTTGAGCAGGAGCCGCT
TGGCAGGGAGGTGCGTCTGGAGCAGGAAGTATTACTGCAG
TGTCGTCCACCAGAGGGCAGCCCGCCTGCTGAGGTGGACT
GGCTAAAGAACGAAGAGCTCATTGACCCGGCGCTGGATTC
TAACTTTCTAATTACCATCGAGCACGACCTGATCATCAAA
CAGGCTCGACTCTCTGACACTGCCAACTACACCTGTGTGG
CACGTAATGTGGTCGCTAAGAGACGCAGCAGCACTGCCAC
TCTCATCGTCTACGTAAGTGGAGGCTGGTCATCCTGGACA
GAGTGGTCAGAATGTAATGCTCAGTGTGGGCGGGGCTGGC
AGAGACGGACACGCAGCTGCACCAATCCAGCACCACTCAA
TGGAGGAGCCTTCTGTGATGGACCGCCCTTCCAGAGAGTC
ACCTGTACCACCCTCTGTCCAGTGGATGGAGGCTGGACCG
AGTGGGCCAAGTGGTCTGCGTGTGGGACGGAGTGCACACA
TTGGCGCAGTCGTGAATGTCAGGCTCCACCGCCACGTAAT
GGAGGACGACACTGCAGCGGCAGCATGATGGAGAGCAAGA
ACTGCACTGAGGGATTATGTGCACGCAATAAAAAGGTTTC
TGTTGAACATACAAGCCATCCTCTGGGCTCTGGGACTGGT
GTCGCGGTGTACGCAGGGCTCGTGGGAGCTCTGCTTCTCT
GTGTGATCCTGGTGTTGTGTGTGGGGATTCTGGTCTATCG
CCGGAGCTGTCGCCATCTTCACGGTGAAATCACAGATTCG
TCATCAGCCCTCACTGCTGCCTTCCACCCCGGCAACTACA
AACCTCCACGACAGGATAATCCACACCTCCTGCATCCAAC
AGCTCCGCCTGACCTCACAGCCAGTGCCGGAACTTTCCGC
GGGCCACTTTTCTCCTTACAACAGGCTACACTGGACTCGC
ACCACAAGATCCCCATGACCACGTCTCCTTTGCTTGACCC
TCTTCCCAGCCTGAAGATAAAGGTGTACAACTCCTCTACC
ATGTCCTCCTTGGAGCTGCCGACCGGCCTGGGGTCTGTTG
ACGGGGATATCATGAGCTTGAAGACTGTTGGCTCTGGACC
TAAAGATCATCATGGCCACACGCTGCCCAGGGAGCCCAGT
CACAGCGCCAGTGCCACGCTGGGCTCACTGGGTGGCCGTC
TCACCATCCCTAATACAGGGGTAAGCCTGCTGGTTCCACC
CGGGACGATTCCTCAGGGCAAGTTCTACGAGATGTACCTC
ATTATCAACAAATGGGAAAAAACAACGTTGCCATCAGATG
GTAGTCAGACAGTATTAAGTCCGGTGGTGAGCTGCGGACC
CTCAGGCATGTTGTTGAGCAGACCTGTGGTCCTCACTCTG
CCCCACTGCGCACAGCTGGAGCCCCCAGACTGGACCCTCA
CCCTCAAAATGCAGAACCATCAAGGTGCTTGGGAGGAGGT
GCTGACTGTGGGAGAGGAGAGTCTATCGTCACCCTGTTAT
CTGCAGGTGGAGGAGCAGAGTTGTCATATCCTGATGGAGC
AGCTGGGCACTTATGGGCTGGTGGGACAGTCGGCTCCTCC
TCGGCCGGCCTGTAAGAGACTGCAGTTGGCCCTGTTTGCC
CCTCGGGCCCCGTGCCTCTCTCTGGACTACAGTCTGAGGG
TTTACTGCATACAGGACACCCCACATGCCCTCAAGGAAGT
ATTAGAGGTTGAGAGAAGTCTGGGTGGGGTTTTACTGGAG
GATCCCAAACCTTTGCTTTTTAAGGACAGTTACCACAATA
TGCGGCTGTCGATCCATGACATCCCTCATTCACACTGGAG
GAGCAAACTCCTGGCTAAGTATCAGGAAATCCCATTCTAT
CACATTTGGAGTGGGAGTCAGCGGCCGTTGCACTGCACCT
TCAGTCTGGAGAGAGGAAGCCTGGTGGTTTCCCAGCTCAC
CTGCAAGATCTGTGTCAGACAGGTGGAGGGAGAGGGACAG
ATATTCCAACTCAACACTGACATCCAAGAGACTTTGCCGC
CCCATTCACCATTGCCAGCAGGCGGTTCATGTCTGCCTTC
GTCTCAAGTGGGCCCATATGCTTTCAGGCTGCCCGTCTCC
ATACGCCAGAAAATTTGTGCCAGTCTGGATGCCCCCAGTG
CTCGTGGCTGTGACTGGAGAATGCTGGCTCGCAGCCTGGC
CTTCGACAGATATCTGAACTACTTTGCAACCAAACCGAGC
CCCACAGGTGTGCTGCTGGACCTGTGGGAAGCCTGCCATC
AGGGGGACGCAGACCTGGTCTCGCTGGCGACAGCTCTGGA
AGAGATGGGCAAGAGTGAGGTCTTGGTTGTCATGACGACA
GATGGCGATTGCTGA

GBrowse:
SEGMENT (CLONE AND PROBE) RELATIONSHIPS
unc5b-201 Contained in:
OTHER unc5b-201 TRANSCRIPT PAGES
  • Vega_Trans:OTTDART00000026118 (1)
  • Ensembl_Trans:ENSDART00000045951 (1)
  • PROTEIN PRODUCTSNo links to external site
    ZEBRAFISH SUPPORTING SEQUENCES
    Type Accession # Length (bp/aa) Analysis
    RNA GenBank:DQ365815 (1) 2935bp
    GenBank:AY764274 (1) 1482bp
    CITATIONS (2)