header logo image header logo text
Downloads Login
Research
General Information
ZIRC
ZFIN ID: ZDB-TSCRIPT-090929-8805
Transcript Name: sarm1-201
Previous Name: sarm1-001

Add new Alias

Alias
Attribution

Attributions for Alias: {{control.newAlias}}

{{pub.zdbID}}

Delete Alias:

(Including Attributions)
Transcript Type: mRNA
Annotation Status:
Strain: TU
Non Reference Strains:
Associated with Genes:
SEQUENCE
OTTDART00000026112 (1) [ Show ] (double-click sequence to select) [Download]
Select Analysis Tool
>tpe|OTTDART00000026112|OTTDARG00000020764|ZDB-GENE-040219-1 sarm1|OTTDARP00000021445 sarm1-001 LG_none BX663513.13,CR522882.5 Danio rerio protein_coding KNOWN, 4019 bp
GCAGGGGGAACCCAACACTGAACAGCACATGCCTGTGATG
CTGAGGCAGATCCTCCACATCCACATCATCTACAAACACT
GGGCGGGTCTACAAGCGGACACTAAGGATGCTCGAAGATC
CTTTATCAACAAGCGTGACTATTTAAAATTTAACGCATTC
AGATTGCTTTTTCAAAACAAATAACTACAACTTCAGTTGG
CTTTCTCAATGGACTCTGTGAGGGTGGGAAAAGGAGAGTG
GAAACAGTCGTCTTTGTCTGACAATTTACAATCGACTTCC
AGTGTACAGCAATACAAGCCGGCGAATGTCTATATTTCCT
CAAAATACCAAGATTCAGCATGCTATTTAGGTTTTAAATA
ACCGTCGCGGTCTCCTTCTGAAGGTGGATTGATCACAAAG
GCTCTGACGTCATTTGTGTTTATATTTTGTTTCTGACATC
AGCGGGATAATGTGCTGTGATGATAACAGTCGCTGATAAT
CAATTATCTCGCATAAGAGTGCAGCTAATAAAGGGAATGA
GTTAAATTTCCGTCACAGTCGATAAACAAAGAAACATAAG
AACGATTGTAGCAACAGACAATCAGCTGGTAGATGTTTTT
GTCCCTCGTCGTTTACCTTAGCAAGATTTGCCGTTATCTC
TCCATGTTTAGCTCCGACAGGCTCACGGTTCCCGAATATG
TCAGTAGTCGGCTGCACAACCGCAGGACGGCCCCCGACCC
CAGGGCTGTGTCCCCGGGGATCAGCACCGACGTCCAGGCC
GTGTTGGACGGCTCTCTCCCCGCGTTGCGCTCTGCTATCA
GAACACTGAGGTCTTCCAAAGACACGGGGGACTTGGAAGA
GACCCGCCGGGCCATTGCTGAGACTTTCCAGCTGGTTGAG
GAGGCCTGGGTCTTGCCCACAGTGGGCCGACGGGTAGCGG
AGGAGATCTGCAACAGAATCCGGCTGGATGGCGGTTTGGA
GCTGCTCTTGCAGTTGATGCAGACTCCTGCTGTGGAAATC
ACATACGAGTCTGCCAAACTGCTTGAACAGATACTGGTGT
CAGAAAACAGGGATTATGTTGCACGTATGGGGCTCGGCGT
CATCCTGAACCTGACCCGTGAGCAGGAGGATGCCCAGCTG
GCACGGAGCGTGTCTGGCATCCTTGAGCACATGTTTAAAC
ACACAGAGGAAACATCTGCACAGCTCATCACCAATGGGGC
GCTGGACACCATCCTGTACTGGTGCCGTGGCACAGACCCC
ACCGTCCTGCGACACTGTGCTGTCGCCCTGTCAAACTGTG
CCATGTACGGCGGCCACCGATGCCAGCGTCTAATGATCGA
GAAGCAGGCGGCAGAATGGCTGTTTCCTCTGGCGTTCTCC
AAAGAGGACGAGCTGATCCGCTTTCATGCCTGTCTGGCGG
TGGCTGTGCTGGCTGCTAATAGAGAGATGGAGAAAGAAGT
AGTGAAGTCTGGCACTCTGGAGCTGGTGGAGCCCTTTATT
GCGTCGTTAGACCCGGATGAGTTTGCGCGTAACATGCTGG
ACAGCGCAGACAGCATGCAGGGCAGAACGGCTGCAGATCT
GCAACACCTGCTGCCTCTGCTGGATGGCACACGTCTGGAG
GGCAAATGCATCGCTGCTTTTTACCTGTGTGTGGAGACTA
GCATCAAATCACGACAACGTAATACCAAGATATTTCAGGA
GATTGGTGCTGTTCAGAGTCTAAAGAGGATCGTCATGTAC
TCCAGTAATGCCACCGTCTGCTCTCTGGCTAAGCGGGCCT
TAAAAATGATGAGTGAGGAGGTCCCGAGGCGCATCCTGTC
ATCTGTACCCAACTGGAAGAGTGGAGAGGTGCAGACCTGG
CTGCAGCAGATTGGCTTCAGTGCATTCTCTGAACGCTTTC
AGGAACTGCAGGTGGATGGAGATCTGTTGCTCAATATCAC
GGAACAGGATCTGATCCAGGATCTGGGCATGACGTCTGGG
CTCACTCGCAAGAGGTTTCTTCGAGATCTACGTGTGCTGA
AAACCTACGCCAATTACTCCACATGTGACCCCAATAACCT
GGCAGACTGGCTGGCTGATGCAGACCCTCGGTTCCGCCAA
TACACCTACGGCCTGGTTCAGTCAGGAGTTGATCGAAACA
ATATAGTCCACATCACAGACCAACAGCTGCTGACTGACTG
CCATGTAGAGAATGGCATCCATCGTGCCAAGATCCTTTCT
GCTGCCCGACGCCCATCTAAACCCTGCTTAACCGATTCCC
AGCCTAAGGGCCCTGATGTGTTCATCAGTTACCGACGCAC
TACGGGTTCACAGCTTGCCAGCTTGCTAAAGGTGCACTTA
CAGTTACGTGGCTTCAGTGTCTTCATCGACGTGGAGAAGC
TGGAAGCAGGCAGGTTTGAGGAGAAGCTGATCACAAGCGT
CCAGAGAGCACGCAACTTCATTTTAGTGCTGTCTGCCAAT
GCTTTGGACAAATGCATGGGTGACGTGGCTATGAAGGACT
GGGTTCATAAGGAGATCGTCACCGCTCTGAATGGAAAGAA
GAACATTGTTCCTGTAACTGATAACTTTGTGTGGCCTGAT
CCAACCTCTCTGCCGGAGGACATGAGCACCATTCTAAAAT
TTAATGGCATTAAGTGGTCCCATGAGTATCAAGAAGCCAC
AATAGAAAAGATTCTGCGCTTTCTCGAGGGATGCCCAAGT
CAAGAGAAACCAGATGGGGCAAAAACGGACAAAAAAGAGC
CACAAAAGAAGTAGAACACTAGTTTAAAAGTCTTTTATCG
CCTGTAATAAGTAGGTGTTTCAAATAATTACACCACAACA
CAACTGTTTACCCCTCAGAGGCCAGTGTTTCCTTCATATT
CTTAATATATGCATGTAGCTGGTCTAATTCCTGTTGGGGA
TATATTTTGGGAAAAGAATGTAATTTACATTGGGATACAA
TAGAGCTTTAAAGGTTTGGACAAAATAGCAACATTTTGGT
GAGATTTCACTTGTTAAAAAAAAAAAATCTTCACTTCCAT
TGTGTGGATTCCTATTGAAAGTACTGGATTTTGTCAATGA
AAATTCACCAGACAACAGCAAATATGACCACAGTTTAATT
AGATTGTTCTTATAAAATGAAAATGCTGTCATTTACTAAA
GATGATTTGAAGAATGTTGGGAACCACTAGCCGTTTACAT
CTATAGTGTTTATTTTTCCTATTATAGAAGTCAATGGCTA
CCGTTGACAACATTCTTCAAAATATCTTCATTTGTGTTCA
ACATAAAAAGAAAGTTTTGGGAAACATTTGAGGGAGAGTA
AATGATCATTTTGATTTTTGGAGTGAACTATCCTTTTAAT
GAACATTTGGAGTGAATTACTAGTACTGCATAATGGAAGT
CGACAGCATAAGTGGCTTTAAATAACACTGAAAATACATC
AGCTGCGCTAAAATAATAATTAATAATCATATAAACTTTG
CTCCTAGAATTGAGGGCGATTTCTATTACTCAGGATTTAT
TGTATTTATGACATCAGCATAAAGCTAAGCATAGTCAATC
CACTGTTATATACTAAATAGTCTTGCATTTAAGCATTAAT
AGATAGACTTTTGGAACATTAAACATAATTTTTTTAAATT
TTCTTCAGTAGGCCCTTCATGGCTAACAAGTTTATGCTGT
CGTTATAGTAAGTACCCTGCATCATTAACATTTTTCACTT
CTGACAAATGTCCCAGCAGTTCATGAAACCCACATTAAAT
CATTATGGTTATTTATCTCCTCATGCAGTATTAACAAAAA
TAGCTCAAAACACTGCTTTAGAGGCTTTCTAAGGATTTGT
GAAAATACTATACAGCTGCTTTGAGTCACAGATACGTTTT
CAGCCACTGTGAGGATGCAAGGGGTCGAGGAAAATGCATT
TAAGAACACTTCAAGCTTTATCCTGCTGTTAAACTCCCTA
CCGTTGCCTTATGATGTTTGTCTTTCAGGTGTAATACAGT
GCGTCAAACCTGTATGAAATAATGTCCTTTTTTTCAGAAT
TAAACAGCAATAAAGCTCG

GBrowse:
SEGMENT (CLONE AND PROBE) RELATIONSHIPS
sarm1-201 Contained in:

Genome Resources: Vega_Trans:OTTDART00000026112 (1),  Ensembl_Trans:ENSDART00000004200 (1)
PROTEIN PRODUCTS No links to external site
ZEBRAFISH SUPPORTING SEQUENCES
Type Accession # Length (bp/aa) Analysis
RNA GenBank:BC163770 (1) 2542 bp
GenBank:AY389466 (1) 318 bp
CITATIONS (2)