header logo image header logo text
Downloads Login
Research
General Information
ZIRC
ZFIN ID: ZDB-TSCRIPT-090929-8745
Transcript Name: mrm3a-201
Previous Names: rnmtl1-001, rnmtl1a-001

Add new Alias

Alias
Attribution

Attributions for Alias: {{control.newAlias}}

{{pub.zdbID}}

Delete Alias:

(Including Attributions)
Transcript Type: mRNA
Annotation Status:
Strain: TU
Non Reference Strains:
Associated with Genes:
SEQUENCE
OTTDART00000026050 (1) [ Show ] (double-click sequence to select) [Download]
Select Analysis Tool
>tpe|OTTDART00000026050|OTTDARG00000020731|ZDB-GENE-050417-184 rnmtl1a|OTTDARP00000021399 rnmtl1-001 LG_ AL954372.6 Danio rerio protein_coding KNOWN, 1370 bp
AGTGACGCGGAAGATGACAACAAAGATGGCGGCGCTCATG
TACAACGTGAGTCGAGGACTTGTGATGTTAGGAGAGCGTA
GTTTATTTCAGAGAGAACGTTACCAGATCTTGGTTAATTC
CAGGCGATTTCTCCGAGGCCTCCGGCGGAGAACCGTGGCT
GTATTGTACCCGGATGGTGAACGAGAGACATTAATAAAAT
CAAAAAGAGTAACTGATATAACGAGCCAGGGGTTCACACA
GAAGGGCAAAGCCAGAAAGGACGTCACAGAGAGAGCTGCT
TACAAAAATTGCAGCGGTTATGTGTCTGAACGCGCAGAAG
AGTCTCCTCAGATTAATAAACTCAAACTTGCAGGGCTGCG
CTTTGAAAAGGCCCCTGCCGGAGACAACAGACTCGCGAGG
GTGTCCAGCGTGGCGCGCTCCAGAGCGTTTCGGGATAAGG
AGGGTAAGGTGCTGCTGGAGGGCCGGCGTCTGATCTGTGA
CGCTCTCTCAGCTGGAGCGTCTCCTCAGATGATCTTCTTC
AGTTTGCTGGAGCGACTGCAGGAGCTTCCTCTAGACAAAC
TACAGCAAGCCAAGCTCATCAAGGTCAAATATGAAGACAT
CAAGATGTGGTCTGACCTGGTCACTCCTCAGGGTCTTATT
GCTATTTTCTCAAAGCCTGATGCCTCCCGCCTGACATTTC
CAAAGGACGCTCGTCTTCAGTCTGTCCCTTTGTTTCTGAT
ATGTGACAATGTACGAGACGCTGGAAATCTGGGAACTACT
CTACGCTGTGCAGCAGCAGCAGGCTGTGACCGTGTTCTTC
TATCCAAAGGTTGTGTGGATGCCTGGGAGCCCAAGGTTTT
ACGTTCGGCTATGGGAGCTCATTTCCGCCTTCCAGTTTTT
CCAAATTTAGACTGGGACGACATTTCTAAGCACTTACCGA
AGAATGTGATTGTCCATGTAGCAGATAACTATAGCACTTC
AACAAAACAACTCGTTTCAGGTCAAACAGAGAACGCTTCT
TCAGATGATTACAGTGAAAGCGACTCTGATGATGATGATG
ATGAAAAAGATGAAGATTCTCTGCCGCATGTGAAGCCTCA
GGTATACCATGAATGTTGGGCTCAGAGGAGCACAGCCCTG
GTCATTGGTGGAGAGACGCATGGACTGAGTGTGGAGGCTC
TTCGTCTGGCTGAGGAAACGGATGGTAAGAGGCTTTTTGT
GCCCATGGCTCCAGGAGTGGAGAGTCTGAACTCTGCCATG
GCTGCTGGTATTTTGCTGTTTGAAGGCAGACGGCAGCTTC
TGATGTTGTCGGACAAATTGCGGAGAAGAGCAAGAACTAA
AATGTTGTAGTAGAGTGTTTTTCTTGTAATGAAAAAAGGG
ATTTCATCAA

GBrowse:
SEGMENT (CLONE AND PROBE) RELATIONSHIPS
mrm3a-201 Contained in:

OTHER mrm3a-201 TRANSCRIPT PAGES
  • Vega_Trans:OTTDART00000026050 (1)
  • Ensembl_Trans:ENSDART00000147900 (1)
  • PROTEIN PRODUCTS No links to external site
    ZEBRAFISH SUPPORTING SEQUENCES
    Type Accession # Length (bp/aa) Analysis
    RNA GenBank:BC093318 (1) 1373 bp
    GenBank:CV488251 (1) 796 bp
    GenBank:CO931646 (1) 793 bp
    CITATIONS (2)