header logo image header logo text
Downloads Login
Research
General Information
ZIRC
ZFIN ID: ZDB-TSCRIPT-090929-8521
Transcript Name: psme3-201
Previous Name: psme3-001

Add new Alias

Alias
Attribution

Attributions for Alias: {{control.newAlias}}

{{pub.zdbID}}

Delete Alias:

(Including Attributions)
Transcript Type: mRNA
Annotation Status:
Strain: TU
Non Reference Strains:
Associated with Genes:
SEQUENCE
OTTDART00000025813 (1) [ Show ] (double-click sequence to select) [Download]
Select Analysis Tool
>tpe|OTTDART00000025813|OTTDARG00000020588|ZDB-GENE-991110-19 psme3|OTTDARP00000021219 psme3-001 LG_ BX001014.6 Danio rerio protein_coding KNOWN, 1636 bp
CTCTTTCTGCACATCTATCATGTATTCGCATCTATGGCCT
CTCTGTTTTACGTCATCTAAAAGCGCGCAAGTGCCTTGTG
GCTGACAGCAGTTAGTAAGCCACACGGTTAGTTAATGCTT
TTAGGACAATCCCTTCATTTTCACATTTCTTGAATTAATA
CGATGTCTTCGCTCCTGAAGGTGGACAATGAAATCAAAAC
AAAGGTTGATGCTTTTAGAGAACGAATTACATCAGAGGCT
GAAGACTTGGTTGCAAACTTTTTCCCGAAGAAATTGTTAG
AACTGGACCAGTTTTTGAAGGATCCCACAATTAATATCAC
GGAGCTGCAGGAAATTCATTCAGAGATCAATCTGACAGTG
CCAGACCCAATTCTGCTTACAGACATCCACGATGGGATTG
AGGGGCAAAATGCTAAAAAGAGGAAATTTGAAGATGGAGC
AGGAGACGACAAAGTTGGCGGGACCAAGGTCTTTGTCATG
CCTGGTGGAATGATGAAAAGCAATGGCAAGCTGGTGGAGC
TGATTGAAAAAGTCAAGCCTGAAATCAGAACTCTTATGGA
AAAATGCAACACAGTCAAGATGTGGGTTCAGTTGTTAATC
CCTAGAATAGAAGATGGCAACAATTTTGGTGTCTCAATTC
AGGAGGAGACGGTTGCTGAACTCAGAACAGTGGAAGGGGA
AGCAGCATCTTTCTTAGACCAGATATCCAGGTACTATATC
ACAAGGGCAAAGCTGGTTTCCAAAATAGCAAAATACCCTC
ATGTTGAGGATTATCGCCGCACAGTGACAGAGATTGATGA
GAAGGAATACATCAGCCTCAAGATTATAGTGTCAGAACTG
CGAAATCAATACGTAACATTACATGACATGATCCTGAAGA
ACATCGAGAAGATCAAGAGGCCGAGAAGCAGCAATACTGA
CGCCCTGTACTAAGACCCCCGTCCCCTTTCCTTCCCGGCC
CGATTCTCCACCATTTGGAGCTCGTGTTAGCTTTCAGGTG
GTTCTAGAATAGTTCCGTCACCCATTATGACCAGGCCAAG
AGACGCACCACTCGATCGGGCCTGATAGAACATGCCACTT
AAGATAGAATTGTAAAATATTGTCACTATTTTAAACCCTT
CAAAATAAGCCCTTTTTTGTTTTGTTTCTTAGCGGACAGT
GTAAATGTATAAAGGCAGAGCCTGAACATGCGTCGCAAAG
AAACTGTCTCCGATTTGTTTTTCTTTATTTAATTAAAGAA
ACACTTCAATCGTGAGTTTCTTTTTTTTATCATTTGCAAA
GCCAAAGTCCATGTAGTTCAGTTTTTGAATCCACTTCTGA
GACTCTCTGGGTCGCGTGATTGATGGATCTACCCTTGATG
GTCGGTTTCTCCGGTCGAGAAGCTCTTATTGATGCTGTAT
TTCACTTAAGCGTTTTGCGTTGTTCATCTGAAATGTACGT
GTAGGCTAAAGAGTGGAAGCGAGGCAGTTCATGTGCAAGA
TTTTATTTGGAGTGTGAGCTGACAATTATTACATGGAGTA
TTATATTTTCATCTGAAACGACTGATTCATCAAATCCTGG
AAGCTTTTTATTGTTCTTTTTGTCCAGTTTTAAGAGTGAT
ACATTTTGCTGAATAAACTATTGTTTTTACAATACA

psme3 TRANSCRIPTS
Type Name Length (bp) Analysis
mRNA psme3-201 1636
psme3-202 (1) 792
SEGMENT (CLONE AND PROBE) RELATIONSHIPS
psme3-201 Contained in:

OTHER psme3-201 TRANSCRIPT PAGES
  • Vega_Trans:OTTDART00000025813 (1)
  • Ensembl_Trans:ENSDART00000002835 (1)
  • PROTEIN PRODUCTSNo links to external site
    ZEBRAFISH SUPPORTING SEQUENCES
    Type Accession # Length (bp/aa) Analysis
    RNA GenBank:BC045495 (1) 1610bp
    GenBank:BC067556 (1) 1581bp
    GenBank:AF195050 (1) 1174bp
    GenBank:CV115310 (1) 727bp
    CITATIONS (2)