header logo image header logo text
Downloads Login
Research
General Information
ZIRC
ZFIN ID: ZDB-TSCRIPT-090929-852
Transcript Name: man1a1-201
Previous Names: man1a1-001, si:dkey-164k19.1-001

Add new Alias

Alias
Attribution

Attributions for Alias: {{control.newAlias}}

{{pub.zdbID}}

Delete Alias:

(Including Attributions)
Transcript Type: mRNA
Annotation Status:
Strain: TU
Non Reference Strains:
Associated with Genes:
SEQUENCE
OTTDART00000006817 (1) [ Show ] (double-click sequence to select) [Download]
Select Analysis Tool
>tpe|OTTDART00000006817|OTTDARG00000006199|ZDB-GENE-041014-321 man1a1|OTTDARP00000006069 man1a1-001 LG_none BX465187.7,BX510906.21,BX548243.16,BX510919.4 Danio rerio protein_coding KNOWN, 7969 bp
GGTTCAGTTGAGGCTGCTGGGACCCCGTTCGCGCAGTGGG
ATCAACTTCTTTCATAGGATCTACCGCGTCCTACTCGGAC
ACCTCGACTTCAATGTAACAGGTACCCAACGCGGCGCAGC
GCAAGGTGATCGGGGAGTTACTTTGTTGCCAAAATCTGAC
ACATTTAGACGGGCTTTTAAACGCAGAAGAAAATGCCTGT
AGCTTCTCTTCTGCCTTTCACGGCCACTCCGAATAGGAAG
TCCGCCAGCCCGACCTCCTTCAGGCTCACGGAGAAATTCA
TCTTGCTTTTAGTGTTCAGCGCCTTCATCACGTTGTGTTT
CGGAGCTATCTTCTTCTTACCGGATTCCTCTAAGCTGCTC
AGCGGAGTTTTCTTCCGCTCGTCCTCGGTGGAGGCAGAGA
CGCGCGCAGGTACGGTCAGTGACACGAGCACCGGGACGGG
CAAAGATGAGAAGATCTTGGCCAAGATCAGAAAAGACCAC
GAAAAAGCGCTGCTCGAAGCCAAGGACACCTTACAGAAGC
GGCCGGACGAGATCAAGGAGGACATCAACAACGATAAGAT
TAAATTTGAGCAAAACCGACCGGTGAAAGATGACAGTTTG
CCGTTCGTACCGTACGTGCGACCGCCTGGAGCAACAGGGC
ACGAGCCCGCAGATCCTGACATTAAAGCTAAAAGAGCCAA
GATTAAAGAGATGATGCAGTTTGCTTGGGACAATTACAAG
CACTACGCCTGGGGATCCAACGAGCTGCGGCCTGTCTCCA
AGCAAGGCCACTCCAGCAATTTGTTTGGTAGTCTCAAAGG
AGCCACCATTGTGGACGCACTGGACACGCTGTACATTATG
GAGATGTATGACGAATTTGAAGCCGCTACCGAATGGGTGG
AAAAGAACCTCGACTTTAACATGAATGCTGAAATCTCCGT
CTTTGAAGTGAACATCCGTTTTGTCGGAGGCCTTCTGTCT
GCCTATTATCTCTCAGGCAAAGAGGTGTTCAGGAAAAAAG
CTGTTGAACTAGGAGAGAAGCTGTTGCCGGCTTTCAAGAC
CCCGACCGGCGTCCCATGGGCTCTTCTCAACCTAAAGAGT
GGGGTCGGCAGAAACTGGCCATGGGCATCAGGAGGAAGCA
GCATTCTGGCCGAATACGGGACGCTGCATTTGGAGTTCAT
GCACCTCAGCGCACTTTCCGGGAGACCGGTCTTTGCAGAG
AAGGTAATGAACATCAGAAAAGTGCTGACTCGGCTGGACA
AACCTCAAGGGTTGTACCCCAATTATCTGAACCCTAACAG
TGGACAATGGGGCCAGCATCACGTCTCAGTTGGAGGCTTA
GGGGACAGTTTCTACGAATACCTGCTGAAGGCCTGGCTCA
TGTCAGACAAAATTGACGAGGAAGGAAAAAAGCTCTACTA
TGATGCCCTGCAGGCGATTGAGAAAAATCTGATCCGGAAG
TCGAGCGGAGGGTTGACGTATATCGCCGAATGGAAAGGTG
GACTCTTGGAGCACAAGATGGGTCACCTGACCTGCTTCGC
CGGCGGGATGATCGCTTTAGGAGCAGACGGAGCCCCTGAT
GAGAAGACGGGTCACCAGATGGAGCTCGCGGCTGAGATCG
CCCGCACATGTCATGAGTCTTACGTCCGAACAAATCTGAA
ACTGGGTCCTGAGGCGTTTCGTTTCGACGGCGGCGTGGAG
GCCATCGCCACTCGGCAAAACGAGAAATACTTCATCCTGA
GGCCAGAGGTCATCGAGACGTACATGTACATGTGGAGGTT
TACCCATGACCCCAAATACAGACAATGGGGCTGGGAGGCA
GTGCAGGCTCTGGAGAAGCACTGCAGGGTGGAGGGAGGTT
ACAGCGGAGTGCGAGATGTTTACAGCAACAATCCAAACCA
TGATGACGTGCAGCAGAGCTTCTACCTGGCTGAAACGCTC
AAATATCTCTATCTGCTGTTCTCAGACGACGACCACTTGC
CCTTCGACCACTGGGTGTTCAACACAGAGGCTCATCCCTT
ACCCGTCATCAAGAAAGAGAGCCCAGAGTTACCAAACCAT
CTCAAGTAAACTTCATTCCATCTCAAGAAACGCCACTGAA
ACACAACTTCCTTCGGCAGTGGACAAGAGCAATGGACGTC
AAAGCGTTGCGGCTGGAGAGTTTCTATCCTCCAGGACTCC
TGCTGGAGCTTTATGTGTTTTCCCCCTTCCTCTGCCGTCT
CTTTTCAGGAATCTGCATGCTGCCCCCTGCCCTCCTCCTG
CTCTCTTTTTTTTCTGTCCTTAACACTATGGACACGTTTC
TGAGCCTCGGAGACCCAGAAGGACCATTTTTTTCCTCTGT
GAGGAGACCAGACCGTTTTCCATCACACTTGCCCTCTCAC
ACACTTTATAAAGCCATAGGTGATTCAAAGTACGTCCACA
TCTTTTTGTATTTTTTTTTTTTTTTTGGCATCATGTGTGT
TTACATGAGCGAAGATGTGAGATCTGTCTACTGAAACTTC
GCCGGCGTCTCTTGCTGTCTGTTTTTTTTCTTCGGCGTTG
AGGTTTGGTTCAGTATTTTGAGGCTTTATTCGACAGCAAG
GTAGTGAAACCAAGTCAACTAGTGCCTTTTAGTCTTAACT
GATCAATGTAGTCCATTTTTAATAGCAACGCTCCATTTAA
TTTCGCCGCAAGCGTCGTTCTACCCTCATTATGGATATAC
ACTACCTGACAAAAGTCTTGTCACCTATCCAAGTTTTAGG
AACAACAAATAATAACTTGACTTCTAGTTGATCTTTTGGT
ATCAGGACTCAGAGTTCATCAAGATTCTTTGGATTCAACT
TCAATACCTCCTCCATCTTACTCAAGGCATACTCAATAAT
GTCAATTTCTGGTGACTGGGCTGGCCATTCCTGGAGCACC
TTGACCTTCTTTGCTTTCAGGAACTTTTATGTGGAGGCTG
AAGTATGTGAAGGAGCGCTATCCTGCTGAAGAATTCGCCG
TTTTTTGTAGTTTGTAATGTAATGGGCAGCACAAATGTCT
TGATATCTCAGGCTGTTGATGTTGCCATCCACTCTGCAGA
TCTCTCGCACACCCACATACTGAATGTAACCCCAAACCAT
GATTTTTCCTTCACCAAACTTTACTGAACTGTGAGAATCT
TGGGTCTATGCGGGTTCTAATAGGTCTTCTGCAGGATTTG
GGACGATTGGGAGGCATTCAACAGATGATTTATCTGGAAA
ATCTGCCACTTTTCCAAATGATCAACTAGAAGTAGAACAA
GTTATTATTTGTTGCTCTTACAACTGGGATCGACGGCAAG
ACTTTTGTCAGGTAGTGTAGAGTCGTTCATTCGTGAGCTT
ACTTTTGTTGCATAGAATGTGTAAAAACTGTTTTAATTGT
TTACTAAATCAAAGGAGGACGAGACTTTTTATCTTTGACA
TGTATAATAGAGTACTTTGTGTTAATTTATTAATCAAGAG
GGTGAAGGGGGTCTTTATTTTTGTAGGTGTGGAGGGCAGG
AATCTACAGAGCTTCTAATGGGATGTGGTGATGGAAAAAT
TAGATGATAGAGGGGAATTATATTTCGGTGATTTAGTGTT
TGTTTGCAATAACATTGTGTTCCCTGAATGAACTTTGCAC
CTGCTTGTGAATCTGTTGTGCTTCCCCACCAAAATGAGCA
TTCTCTTATTAAAAGTACGGCTTTTATGTAATTTGTGAGG
ATATTTTCTCCTGGGAATGGCAAGCAATGCAAAGTATTTA
ATTTTTTGAGAAGCTTCGCATTCCTTTAGAAAAGTTCTTT
CAGAAATGTATTCCATTTTCTAACAAATGTATTACATTCC
CTCTAGAATTATTCTATTGCACAACAGTTGCGTTCTCTTA
TAATCTCTCCCCATTGATGCAATAGTTTTCTAAGAGGACA
TACAAACAATCAAAATGATTGGTATATTTCTTTGAGGAAT
GCAATGTTAATTTAGTTACCCAAAATAGCTTGACACAAAC
AGAAACTTAATAATATTAACAATAATACATTTTGTTTATA
ATGCGCTTTTCTAAAACCCAAAGCGCCATGTTTCCTTTCA
AAAATGAGTTTTCTAACAAAGAAATGTTGTTGCACTAAAA
TAGTTTGTTTTCCTGCTTAAATAAATCATATCATCTCCTT
TTTAAAAGTTTAGCTAATGAAAAGTTTTTCAGGGAAATTA
AAAGCTTTGTGAGAGAAAAACATTTCTCAAGAGATCTAAA
ATTTGGCAAGCAAGTTTGCAAGAACACAACAGATTTTGGA
GCAGTGCAGAAGTTTGTTTGAAGATGATATAAATATAACT
TTCCCTTCCTGGGGTCCGTTCTTCATACATGGATTACTCA
ATTAGCTGGATTTGGTTACTGACCATTTGACATGATCCAG
GATTGTTTTTCAATCCATAGCTCAAACATATGAACAGGAT
TAGATCGGGTCTTTTCAAGCAAAGGTAATACTGAAAGTAC
GGAATCTGATATCTTCTTATGCTGTGTTCACACCAGACTT
AAATCGCACATCCGCATGTAAGAAGATGCATGAACATTTT
GAGATTTACTCGCTTCATTTGTGCGTCAAATTCGTTTCAT
TTATGCGTCAAATTCACTTCACAACAGACGCGGATTTGCA
TCATGGGCAGGGTTTCTGTCTGCCCGGTGACTTTAGTTTT
GTTGCTAAATGGCTAACATGGATTTTATTGTGAGAATAGC
TGTGTTTATGTGCTTTAGGAAGACTGAAAAACAGCGCAGA
TTCGTTTGGAGCCATGTCTTAGTCCACAAGATCCATTCAG
AGGTGCACCTAGCTCTGTGAGCTCATAAACCCCTCCAGAA
ACTATACCTGGATGAGGGAAGCTTTCAGCAGTACTTCCGG
CACCAGCCGAGCCCAGTTTGATCAACTGTATTTCGGTTCG
ACAGGAGGATTTCCCCTCGGGACACCAACTACAGGAACTA
CATCATAATCACTTCCCTACAAGAGCAAGCTCCTGATTGG
TTAACGCGGTGCGAATGTCTGCTAAAGTTCAGATTTTCCA
GATTTTCATGTCAATCATGCAAAACACTCAACTCGCGCCG
CTTCATTCGGGCAAATTCAGTCTTTTGTGCATCTCATTTG
CACGTATCCCGCCGCAAGATGTTTATTTGCATCTTTGCAT
TGACTTAACACTCGTAAATCACTCGTGCCTGGTGCTTCTT
CCGTGTCTAGTGTGAACGCAGCATTACAGTAGTACTTATA
TAGACTTGGGGGAAAAAAGTATGCAATCTGCACTCCAAAA
TAACAGAACAAACAGTCACGGGGTGGTTCTCCCCAAAGGG
TTCAAAGAGAGTGTTTATTATTATGGATTTTTTAGACACA
AATGCACACCAAGGTACCAGCTTTAGTACAGTTCGTGTAT
GATAATAGACATGCACAATATTCGATTTTTTTTTTAACAA
TTAAAATACAATGCACATGTTTTGACAACTAAGATGAGAG
TGATTTGATGTTTTGCAAAAGTTGCAGACGCCTTTACCAA
CATCAAACCGCTTTTTTTTTTTGATGCAGAATTCATTTAA
ATATACAGTTATTCCTGTATATACCGATTAAGAAACTTGA
ATAGGCCTGGGCTAATATAATAAAGAAAATTCATTCTAAA
CTAAATAAACTAAATAAATTGCTAAATACTCTCAACACAT
GAAAGTGTAAAGCCTGCAACCCACAACAGATGTAAAAATG
TATTGCGTATCATATTTAACAAACTTTTTACTACAAATTT
TATACTGTTTTGCTCACATGGATAATTGAATATTAATCAG
ATGATGTCATAACACTGCTGTGCCGTCAGCCATGTTGCAT
TGCTCATCACAATTTCGAGGATCGATATAGATCTGTCCCT
CAAAACACATGCAGCGATATCATGTCAGTTCATCTAGACA
TTTTAATCTGATTCCAAATTAGCCAGAGATCAGCTATCAG
GATTAAATGTTCCAGAATCTGACAAATCATCTAAGATTGT
TTTAGCAAGGTACGAAGAACGGACCCCTGATTTTTATTTG
TTTATTAATATTATTTACCATCACCACGTTTTCTGGACTT
CCATTGGAAACAGCGATAAAGCTGCTTGAATCTTTTGTGT
TTTATTAGGACAAGATGGGCAGTGTTCGTAAAAAGGGGAG
TGAATATTAGTTTGAATGTACCACCAAATGTGAATTGAAC
ATACTTTGGCCTAGCTGTTGTGATTTATCATTTAATCTGT
TTGTCTGTTCGTGTGTTCGTTTGATTTAACATGAAAGCAC
AACGTTGTGAATCAGTATATTGGGGTTCTCCGTGTAGAAA
AGGATAGGACAATTACTGTAGGATGACAAAGACGGCAAGT
TCTTTAAATGGAAAACAAGATGCAAACCAATGAATTCAAA
GCAGTCCATACCACTGGATACAACACACACAAACACACAC
ATGATGAAGTAATAATGCATTCACATCACATACACTACAA
CACATTCCAAATCATGCACAAACAATTGGATCAGTTTCCG
TCTTTAAAGTCCGTGTGAGTCGGAAGTTGCTGTGACTTTT
ATATTGATGTACTTCCAACTGAAATGGAATTTTGAGTAGG
GGGCGGGGCTTTCTGTTTGCATATCATTTTCTCGTAGCAA
ACTAAACATAAAAGGGGTGTGGTTAATAATATCGTGGCTG
AAACCGGCAAACGGTTTAACATCTCATCTGAAAAACAGCG
CTCACCGTGCTGTATAGATTTCCCTTCACTATACTGGGGC
GTTAGGTCCCACACAGACTGCAGGTTGATTCAAAACCTGC
GCCAGCAAAATAAACGTAAATTGTGATATCACACGGACTT
TAATGATAGATTTTGTGAAATTGACGCAGGGCGTGCTTAA
AAAAACGTCTATATTTAGCTAGCTATATTCAGTTTCCCAA
ACCCATCATGTTTAACTAGTATGGTGTGGTGCTTTAAACA
ATGTATTATACTAGCGGATCTACATGGGGAAATGATAAAT
ACTAATACCTCGCAGGGATTCCTCTTTTGAGGCCAGCGAC
TGCAAAACTTGACATGGTATTTCTGCGCTGTACGTATGTA
TGCTAGCGAAAGTGCGTGCTGTCGGAGTTCGGAAGCGAAA
TAAATCAAAGTACCGTCATCTGGAGGGAGGCCTGTCATAA
AACACTGTGACACTGTAGATAAGACATCGCATTCACTGTA
TTCATGATACTGCGAATCTAAACCATGTTTAGCACTGCCG
CGGCTTAGCGTGGGCTAGCGCTTTGTGCTGTCTCTTTCGT
GAAAGTGATTCCTCAAGCTGTGAGTGAGGATTCGCAGCAA
ATCTTATGCTGGGTTCAACAACAAACGCGGAATTAAGTAA
TTGCGCAAGTAATTTACATACAAAGTTGATGCGTGAATAG
AGGTGAATTATCATCGTTCATGAAAGTGCAGGATTTGCCT
CAATTGCGTCTGTCGCACAAGTTCAAGTAAATGTCGAAAA
TTCAGATGAGGAGGGAAAACATTCTGTGAGTAAACTAGAG
CGAATGATAGCATTTGGTGTGAACTCAGCATTTGTGACAT
TCGGGAACAGACGTTTCCTCGCAGATACGCAGAATAGAAG
ACGTGCTTTTCAGATTAAATATTAGTTGTTTAAATATTGT
GTTGATGATCTTGCATAGAAAATGCCTTTTTGTTTGTGAT
TCTTGTTGTTCGTTACTTCTTTTATGAGACAACCTCAGAA
ATGTAACTGTACAAAATTGCTGATAATCATTCCATTGCAC
ATAGTCGGATTTTGGTTTTCTTTATATATGCAATTATGTT
TGTGGGAAATTGTTTGGTTATGTTTAATTTTATTTTTTAA
TTTGTCTTTCTTTTTTTAATTGTACATATTCCATTCTGGC
AAACTGCCAGCCATCATTTATATAAATCTTAAGATCTTAT
GTAATAAATTATATTAAAGAGCAGCAAAGGTTTTTGATAA
ACTATATTTGTTACACTTCAATTGTGAATAAAACAATCTT
TTATTATAA

GBrowse:
SEGMENT (CLONE AND PROBE) RELATIONSHIPS
man1a1-201 Contained in:

Genome Resources: Vega_Trans:OTTDART00000006817 (1),  Ensembl_Trans:ENSDART00000146052 (1)
PROTEIN PRODUCTS No links to external site
ZEBRAFISH SUPPORTING SEQUENCES
Type Accession # Length (bp/aa) Analysis
RNA GenBank:EH544364 (1) 896 bp
GenBank:BQ479592 (1) 550 bp
GenBank:CR929650 (1) 539 bp
CITATIONS (2)