ZFIN ID: ZDB-TSCRIPT-090929-8417
Transcript Name: cyp26a1-002
Previous Name:

Add new Alias

Alias
Attribution

Attributions for Alias: {{control.newAlias}}

{{pub.zdbID}}

Delete Alias:

(Including Attributions)
Transcript Type: mRNA
Annotation Status:
Strain: TU
Non Reference Strains:
Associated with Genes:
SEQUENCE
OTTDART00000025699 (1) [ Show ] (double-click sequence to select) [Download]
Select Analysis Tool
>tpe|OTTDART00000025699|OTTDARG00000020512|ZDB-GENE-990415-44 cyp26a1|OTTDARP00000045197 cyp26a1-002 LG_ BX323992.9 Danio rerio protein_coding KNOWN, 835 bp
ACATGCATTTGTGAGCTTTGTGCCAATAACGCATCTCCAT
CACACACAGAGAAGGAAGTTTCTGCGCATGAAACGGCAGA
AATACGGGTGCATCTACAAGACGCACCTCTTCGGGAACCC
GACTGTCAGGGTGATGGGAGCTGATAATGTGAGGCAGATT
CTGCTGGGCGAACACAAGCTGGTGTCTGTTCAGTGGCCAG
CATCAGTGAGAACCATCCTGGGCTCTGACACCCTCTCCAA
TGTCCATGGAGTTCAACACAAAAACAAGAAAAAGGCCATT
ATGAGGGCGTTCTCTCGAGATGCTCTGGAGCACTACATTC
CCGTGATCCAGCAGGAGGTGAAGAGCGCCATACAGGAATG
GCTGCAAAAAGACTCCTGCGTGCTGGTTTATCCAGAAATG
AAGAAACTCATGTTTCGGATAGCTATGAGAATCCTGCTTG
GTTTTGAACCAGAGCAAATAAAGACGGACGAGCAAGAACT
GGTGGAAGCTTTTGAGGAAATGATCAAAAACTTGTTCTCC
TTGCCAATCGACGTTCCTTTCAGTGGTCTGTACAGGGGTT
TGAGGGCACGCAATTTCATTCACTCTAAAATTGAGGAAAA
CATCAGGAAGAAAATTCAAGATGACGACAATGAAAACGAG
CAGAAATACAAAGACGCTCTTCAGCTGTTGATCGAGAACA
GCAGAAGAAGTGACGAACCTTTTAGTTTGCAGGCGATGAA
AGAAGCAGCTACAGAGCTTCTATTTGGAGGTCATGAAACC
ACCGCCAGTACTGCAACCTCACTAGTCATGTTTCTGGGTC
TGAACACAGAAGTGGTGCAGAAGGTCAGAGAGGAG

cyp26a1 TRANSCRIPTS
Type Name Length (bp) Analysis
mRNA cyp26a1-001 (1) 1830
cyp26a1-002 835
SEGMENT (CLONE AND PROBE) RELATIONSHIPS
cyp26a1-002 Contained in:
OTHER cyp26a1-002 TRANSCRIPT PAGES
  • Vega_Trans:OTTDART00000025699 (1)
  • PROTEIN PRODUCTSNo links to external site
    ZEBRAFISH SUPPORTING SEQUENCES
    Type Accession # Length (bp/aa) Analysis
    RNA GenBank:CN020329 (1) 856bp
    CITATIONS (1)