header logo image header logo text
Downloads Login
Research
General Information
ZIRC
ZFIN ID: ZDB-TSCRIPT-090929-8416
Transcript Name: cyp26a1-201
Previous Name: cyp26a1-001

Add new Alias

Alias
Attribution

Attributions for Alias: {{control.newAlias}}

{{pub.zdbID}}

Delete Alias:

(Including Attributions)
Transcript Type: mRNA
Annotation Status:
Strain: TU
Non Reference Strains:
Associated with Genes:
SEQUENCE
OTTDART00000025698 (1) [ Show ] (double-click sequence to select) [Download]
Select Analysis Tool
>tpe|OTTDART00000025698|OTTDARG00000020512|ZDB-GENE-990415-44 cyp26a1|OTTDARP00000021124 cyp26a1-001 LG_ BX323992.9 Danio rerio protein_coding KNOWN, 1830 bp
TTTGTGCGTAAAGACGCGTCTCCTCTCCAGAAGCTTGTTT
TTCGTTTTGGCGATCAGTTGCGCGCTTCAACATGGGGCTG
TACACCCTTATGGTCACCTTTCTCTGCACCATCGTGCTAC
CCGTTTTACTCTTTCTCGCCGCGGTGAAGTTGTGGGAGAT
GTTAATGATCCGACGAGTCGATCCGAACTGCAGAAGTCCT
CTACCGCCAGGTACCATGGGCTTGCCGTTCATTGGAGAAA
CGCTCCAGCTGATCCTCCAGAGAAGGAAGTTTCTGCGCAT
GAAACGGCAGAAATACGGGTGCATCTACAAGACGCACCTC
TTCGGGAACCCGACTGTCAGGGTGATGGGAGCTGATAATG
TGAGGCAGATTCTGCTGGGCGAACACAAGCTGGTGTCTGT
TCAGTGGCCAGCATCAGTGAGAACCATCCTGGGCTCTGAC
ACCCTCTCCAATGTCCATGGAGTTCAACACAAAAACAAGA
AAAAGGCCATTATGAGGGCGTTCTCTCGAGATGCTCTGGA
GCACTACATTCCCGTGATCCAGCAGGAGGTGAAGAGCGCC
ATACAGGAATGGCTGCAAAAAGACTCCTGCGTGCTGGTTT
ATCCAGAAATGAAGAAACTCATGTTTCGGATAGCTATGAG
AATCCTGCTTGGTTTTGAACCAGAGCAAATAAAGACGGAC
GAGCAAGAACTGGTGGAAGCTTTTGAGGAAATGATCAAAA
ACTTGTTCTCCTTGCCAATCGACGTTCCTTTCAGTGGTCT
GTACAGGGGTTTGAGGGCACGCAATTTCATTCACTCTAAA
ATTGAGGAAAACATCAGGAAGAAAATTCAAGATGACGACA
ATGAAAACGAGCAGAAATACAAAGACGCTCTTCAGCTGTT
GATCGAGAACAGCAGAAGAAGTGACGAACCTTTTAGTTTG
CAGGCGATGAAAGAAGCAGCTACAGAGCTTCTATTTGGAG
GTCATGAAACCACCGCCAGTACTGCAACCTCACTAGTCAT
GTTTCTGGGTCTGAACACAGAAGTGGTGCAGAAGGTCAGA
GAGGAGGTTCAGGAGAAGGTTGAAATGGGCATGTATACAC
CGGGAAAAGGCTTGAGCATGGAGCTGTTGGACCAGCTGAA
GTACACTGGATGTGTGATTAAAGAAACTCTCAGAATCAAC
CCTCCTGTTCCTGGAGGATTCAGAGTCGCACTCAAAACCT
TTGAATTGAATGGTTACCAAATTCCTAAAGGATGGAACGT
CATTTACAGCATCTGTGACACGCACGATGTGGCCGACGTC
TTTCCAAACAAAGACGAGTTCCAGCCGGAGAGATTCATGA
GCAAAGGTCTGGAGGACGGGTCCAGGTTTAACTACATCCC
CTTCGGAGGAGGATCCAGGATGTGTGTGGGCAAAGAGTTC
GCCAAAGTGTTACTCAAGATCTTTTTAGTTGAGTTAACGC
AGCATTGCAATTGGATTCTCTCAAACGGACCCCCGACAAT
GAAAACAGGCCCGACTGTTTACCCAGTGGACAATCTCCCT
ACCAAATTCACTAGTTATGTCAGAAATTAGCCTAACCGGA
GCTTTGTACATATGTTTTTATTTTAGATGAACTGTGATGT
ATTGGATATTTTCTATTTTGTTTATATAAAGCAGATGTGT
ATATAAGTCTATGCGAGGAAGCGAAAACGAGGGCACTACT
TTCTCATGGATCACTGTAATGCTACAGAGTGTCTGTGATG
TATATTTATAATGTAGTTGTGTTATATAGCTTTTGTACTG
TATGCAACTTATTTAACTCGCTCTTTATCTCATGGGTTTT
ATTTAATAAAACATGTTCTTACAAATTTCA

cyp26a1 TRANSCRIPTS
Type Name Length (bp) Analysis
mRNA cyp26a1-201 1830
cyp26a1-202 (1) 835
SEGMENT (CLONE AND PROBE) RELATIONSHIPS
cyp26a1-201 Contained in:

OTHER cyp26a1-201 TRANSCRIPT PAGES
  • Vega_Trans:OTTDART00000025698 (1)
  • Ensembl_Trans:ENSDART00000041728 (1)
  • PROTEIN PRODUCTSNo links to external site
    ZEBRAFISH SUPPORTING SEQUENCES
    Type Accession # Length (bp/aa) Analysis
    RNA GenBank:BC055232 (1) 1848bp
    CITATIONS (2)