header logo image header logo text
Downloads Login
Research
General Information
ZIRC
ZFIN ID: ZDB-TSCRIPT-090929-8411
Transcript Name: dkk1b-202
Previous Names: dkk1-002, dkk1b-002

Add new Alias

Alias
Attribution

Attributions for Alias: {{control.newAlias}}

{{pub.zdbID}}

Delete Alias:

(Including Attributions)
Transcript Type: mRNA
Annotation Status:
Strain: TU
Non Reference Strains:
Associated with Genes:
SEQUENCE
OTTDART00000025693 (1) [ Show ] (double-click sequence to select) [Download]
Select Analysis Tool
>tpe|OTTDART00000025693|OTTDARG00000020510|ZDB-GENE-990708-5 dkk1b|OTTDARP00000021120 dkk1-002 LG_ BX649533.5 Danio rerio protein_coding KNOWN, 1133 bp
GCTCCGCTCACCCAGGGAATACATCCTACAATTCAAGGAA
TAACATGATGCACATCGCCATGCTCTCTACTGCATGCCTC
ATTTTTATGGGCTGCATCAAAGTGGCCGGTTCTACGATGC
TCAACTCCAACGCTATTAAAGTCGGTTCAGGTGCGGCGGG
TGCCAGTCATCCGGTTAGCCCGAGTCCGGACGTGTCACTT
TTGGACAGTCTGAACTTCGCCCTCGATACACCGCAGCCTT
TAATCTGTGAGAGTGATGAGGAATGCGGTGGAGAGGAGTT
TTGCTTCCAGTCTCGCGGTGTCTGTCTCCAGTGCAAGAAG
CGCAGGAAGCGCTGCATCCGGGATGCGATGTGCTGCCCTG
GCAACCACTGCAGCAATGGTGTTTGCATTCCAAATGACCC
TGACATGATTCAGCAGCTTGGCATGGAAGAGTTCGTGTCC
ATCGCCCATGAAAACTCTACTGCTCTAATGCCGAAAGTTT
CGACTCAAGGATCACCACAAAACCAGATGCTGAAAGGTCT
GGAGGGAGAGAACTGTCTGAGATCATCAGATTGTGCAGAG
GGACTTTGCTGCGCTCGTCACTTTTGGTCCAAAATCTGCA
AGCCTGTCCTAAAAGAGGGCCAGGTCTGCACCAAGCACAA
GAGGAAAGGCACTCATGGCTTGGAGATATTCCAGCGCTGC
GACTGCGGGGAAGGCCTGTCCTGCAGAACGCAGCGAGGAG
ACGGCGGCAAGGCTTCACGGAGTCTGCACACATGCCAGAG
ACACTAAATGAAAATTCAAGGAATTTTCTTTCACCAGCTC
CCAGAGAAGCAGACTTGAGTCGAGGGAAGCAGGACTTGGA
ATGGGATACTCTGTTTTTCAACTGGTTTCCTTCATATTCT
CGAGTCAACATTGAAGAGTAGATTTAATTGTTTCTCAACG
GAACTTAAATAATTGCAGTAAATTACTGTATTATACTGTA
AATAATATAAGGCAGTTGGCACTTAAATATTTTTGTCAAC
CCTGTTATGAAAGAAGGTGCATCAGTCTTTTCTAGTCTAC
CTTAAATGTATATACATTCATTCTACAGTCATATAGAGCT
GATTTAAATGTCTATTTTATTCTAAATAAAGAGTGTACAG
ATGATATACAGCA

dkk1b TRANSCRIPTS
Type Name Length (bp) Analysis
mRNA dkk1b-201 (1) 894
dkk1b-202 1133
SEGMENT (CLONE AND PROBE) RELATIONSHIPS
dkk1b-202 Contained in:
OTHER dkk1b-202 TRANSCRIPT PAGES
  • Vega_Trans:OTTDART00000025693 (1)
  • Ensembl_Trans:ENSDART00000122271 (1)
  • PROTEIN PRODUCTSNo links to external site
    ZEBRAFISH SUPPORTING SEQUENCES
    Type Accession # Length (bp/aa) Analysis
    RNA GenBank:AB023488 (1) 1177bp
    GenBank:DV598280 (1) 800bp
    CITATIONS (2)