header logo image header logo text
Downloads Login
Research
General Information
ZIRC
ZFIN ID: ZDB-TSCRIPT-090929-8359
Transcript Name: rer1-202
Previous Name: rer1-002

Add new Alias

Alias
Attribution

Attributions for Alias: {{control.newAlias}}

{{pub.zdbID}}

Delete Alias:

(Including Attributions)
Transcript Type: mRNA
Annotation Status:
Strain: TU
Non Reference Strains:
Associated with Genes:
SEQUENCE
OTTDART00000025639 (1) [ Show ] (double-click sequence to select) [Download]
Select Analysis Tool
>tpe|OTTDART00000025639|OTTDARG00000020481|ZDB-GENE-040426-1494 rer1|OTTDARP00000021078 rer1-002 LG_ BX005339.7 Danio rerio protein_coding KNOWN, 1154 bp
CGCGGATCGGTAGCCGAAAGTGACACAGCGGCACAACCGG
ACAGAATGCCAGAAGGAGACAGTGCCGGTGAATCCATCCA
TGGGAAACCATCAGCGATCGGGAACTTCTTTAAGCGGCTC
GGACAGATTTATCAGTCATGGTTGGATAAGTCAACGCCGT
TCTCAGCAGTCCGATGGGCATCCACGCTTATTCTAACGGC
CATATATATGATCAGAGTATATATACTACAGGGGTGGTAC
ATAGTCACATATGCTCTTGGGATCTACCACCTTAACCTCT
TCATTGCTTTCCTCTCACCAAAAGTGGATCCCTCATTGCT
CGATGATCCAGATGAGGGTCCGGCACTACCCACAAAACAG
AACGAAGAGTTCCGGCCGTTCATCAGGAGGTTGCCAGAGT
TCAAGTTCTGGCATTCAGCGACGAAAGGCATCGTCATCGC
TATGATTTGCACATTCTTCGACGCCTTTAACGTGCCAGTG
TTTTGGCCCATCCTCGTAATGTATTTCATCATGCTGTTCT
GCATCACCATGAAACGGCAGATCAAGCACATGATCAAGTA
TAGATACCTGCCCTTCACACACGGGAAGAGGACTTACAGA
GGCAAGGACGACACAGGGAAAACCTTTGCTAGTTAAAATT
CCCCTTCCTGAAATTAAAGTTATTGATGAAGAATGAGGAA
ACATAAAGTTGAGTGCTTTAACTATTGCAAATGGATGGAG
AGGGTTGAAGGTTGTTGTTCTTTTTTGTTTTGTTTTTTTT
TCCTCCATTTTGTGCTGGGCCATAACAACTATTAGAGTTT
TTCTTAAGGGCAAATGCAGAGAACTTCAGTAACTTAAGCA
TTCAGGAGGACTTTTTCCTGTCAAAGTGCAGTTTTTTGGG
GGAGGGGAGATATAAATATATATATAAAATGTATAATGTT
TAATTTTTTTTAAATGGTTAGCATGTTTGAGTTCTTTCTT
TTTCTGATAATGCCATTTTTACTGTATTAAATTCAGTCAT
CCAAACGAAAATAGGTTTGTTAATTCCTGATTAAAGACAT
TGCATGTTTTAGCTTTTCTTGTGCTGCTGGTTCAAGAGAA
AACGAGATGATTTTAATAACTAAGTGTACATTTTTTTTTC
ACTCCAAATGCTATTAAAAAGCTGTGTTCCTTCA

rer1 TRANSCRIPTS
Type Name Length (nt) Analysis
mRNA rer1-201 (1)    Ensembl 2222
rer1-202 1154
SEGMENT (CLONE AND PROBE) RELATIONSHIPS
rer1-202 Contained in:
[BAC] DKEY-71C4 (1) (order this)

Genome Resources: Vega_Trans:OTTDART00000025639 (1),  Ensembl_Trans:ENSDART00000132035 (1)
PROTEIN PRODUCTS No links to external site
ZEBRAFISH SUPPORTING SEQUENCES
Type Accession # Length (bp/aa) Analysis
RNA GenBank:BC050162 (1) 1288 bp
GenBank:BC058292 (1) 1180 bp
CITATIONS (2)