header logo image header logo text
Downloads Login
Research
General Information
ZIRC
ZFIN ID: ZDB-TSCRIPT-090929-8316
Transcript Name: popdc2-201
Previous Name: popdc2-001

Add new Alias

Alias
Attribution

Attributions for Alias: {{control.newAlias}}

{{pub.zdbID}}

Delete Alias:

(Including Attributions)
Transcript Type: mRNA
Annotation Status:
Strain: TU
Non Reference Strains:
Associated with Genes:
SEQUENCE
OTTDART00000025590 (1) [ Show ] (double-click sequence to select) [Download]
Select Analysis Tool
>tpe|OTTDART00000025590|OTTDARG00000020456|ZDB-GENE-060518-2 popdc2|OTTDARP00000021041 popdc2-001 LG_ BX511129.15 Danio rerio protein_coding KNOWN, 2645 bp
AGTCCAGTGTGGGACGGGGAACAGAAGCACAGACACTGGA
GGGCTGATATTGTCAAATTTAAAAGGAAGAGTGGGTGTCG
AAGGAAACTAAATTATGAAGCTTCTTTTATTCCAGCTGAT
TTTGGCCGTAGGAGCGACATTGACTTTAAGCAGCTGAAGG
GAACAAGCTTTTTATATTCGACATTAGTTTGGCATTTTGT
TTACAATCTTTTAAAAACTTGAATTATTTTTCCAGAATTT
AATGACAGGCTTCTTATAATTCAGCGTTCCATTGAATTGG
AGACAGCAGAGGCTCAAACATGAATAGCGGCGACTCTTCA
TTGATTGACGCTGTAATTTACAATCACACACTCTGCGATG
GATGGACCAACAGCACTGAAGGTGCCATATACCATCTGGG
CAACACCATTCTTTTTCTGGGCTATATGGGCGGTAGTGGG
GCGTATGGGGCTCTGTACATCTTCAGTTTTCTGGCTCCAG
CTTTCCTCTGTCTGGCTCTCTGGGGCTGGCTGACGATGTG
CGGCCTGGATGTCTTCATCTGGAACCTGCTGCTGATGCTG
CAGTGTTTGGCCCAGGTGTGTCATCTGATTTTTCGGCTGA
TGCGGGACGGTTTAGCTAACGAGGAGTTTTCTGCACTTTA
CACAGCGGTCTATCTGCCGCTGGATGTACCTGTGCAGGTG
TTTAAGGAGATCACGGGGGCCGGAGAAAATAAAGTGCTTT
CTCTAGCGGCCGAAGAAACGTATGCCGTAGAAGGGAAGAC
GCCTATTGATCAGCTGTCTTTCCTACTTTCTGGCAGGATT
AGAGTGTCTTTGGAGGGCCAGTTTCTCCATTACATCTTCC
CTCACCAGTTTCTTGACTCTCCAGAATGGGAGTCTTTAAG
ACCGGCAGAGGAGGGGAACTTTCAGGTGACACTAACCGCG
GAGACGGACTGCCGCTACATCTCTTGGCGCAGACGTCGGC
TTTACCTTCTGCTGTCTAAAGATCGTTACATTGCCCGACT
TTTCTCAGTCATGCTCGGAAGTGACATCGCTGACAAACTG
TACTCACTCAATGACAAGCTATTTGCAAAGAGCGGTGTGC
GCCTTGACATTCGTCTGCCCAGTCTATACCATGTCCTTGC
CCCTTCGCCACCAGGCAGTGAGGGTGGCAGCGCCAGTTCA
CCACCCAGGGGGAGCCTAGGAGACCCTACAGTCATAAAAG
TTGATCCGGCACCATCTAATCCAGGCTCAGGCACAAGAAA
TCCCCAGCCGGACCAGGGAAAGAATCCTGTTCCCAAAAAT
CCACACCAGCATTGGTCCTCGGACACAGAGATGCCCTCCG
GTGAGGACTCAACCAGCTTGATTCTGGAGGACTTTGCAGA
TATGACAGGCTCTCTAATGGACTATGGGCATGAGAGGGAA
TATTTGAAGTAAAGATATGGGTGTTAAAGCTAACACACAC
TTGGACACTTCTTAAATCACAATAGGACGATCCTCCAGGA
CGTTTTCCACCTCGATACCAAAGAGGACGTGCCCCACTGG
CCCCTAATGACACCCCAAAGCTGTAGAGACGACGAGTCAA
GATGAATCACTTCTCCCATCAAAAACTGTTTGTTCTCATA
CGACCACACTCACACAGAACAGTTTAAGGATGTGCAAATG
TACTGCTTTCAGGACAAAACCTCCCAAACCACTGTTTTTT
CCGATAGATACTGTGTTATATATGATTCCACATTGCTGTG
ATTGATCAACATGGCTGATTTATGTTTATTTGCAATAGTG
TGTCCTTTGTAGGGAAGTCTGTTTGGAATAACTGAGACAA
AGTTTAAATACTACAAATTAAAAAATTAACACTTCAGCAG
TCGAAAGATATTAAATTGATAGAGATTTATTACATAAGTG
TGAGTTTAATCATATTAGAATGCTAGTAAATGTTTCAGAA
TCTTGTTATTGAGACTGACCATTTTGTGAAAATGTATTTT
CACGGGGCCAACTGTTAAGTGCTGGGTTAAAATGTGACTT
GATATTCCTCTTAAGATGCCACCATAAAGCAGTAATTAGC
ACCGTATTAGGTATGCAGTTACAAACACTAATGAGGGTAA
TAAAATGTTGCTTGAATGTTGTTGTACCACTTCAAATGAT
CAAACATCAGTACTTTCAGTACACATATGAACACACAGAA
TAGCTATGGTATGGTAAATGTCTTTTATAATACACAATAT
TTCTCTTGTTGATTGTTATCTAACAAAACTGAACAGAAAA
TTTGCATTAAAGGGACAGTTCACCCAAAAAGGGAATTTAC
TGCCCATCAAGTTGTTCCAGACCTTTATAAGTGTCTTTTC
TTGATTGAATACACAAGAAGAGATTTTGAAAAATGTTAGA
AACTGGTTGCTGTTGAAGTCACTACCAATGAAAGTCAATT
TTAATTTCAGGGTTTCAAAATCTCTCTTGCTCTCAGTAAA
AGTCAGAATCTCAAACAGGCCTGAAAAAGTGAGTAAATGG
TAACAGAACTTTTATTTTTGGGTGAACTCTCTCTTTAAAT
AAAACTGATTTTCTCAGGAAGAGCTCACAGATAAAACAAA
AGTATCAGAAATCATATTTGATATTATATTAGGGCTAAAT
GTGTCATTTTGTGAAAACACAATAAATAAATCTAACACTG
AATCA

popdc2 TRANSCRIPTS
Type Name Length (bp) Analysis
mRNA popdc2-201 2645
popdc2-202 (1) 2476
SEGMENT (CLONE AND PROBE) RELATIONSHIPS
popdc2-201 Contained in:
OTHER popdc2-201 TRANSCRIPT PAGES
  • Vega_Trans:OTTDART00000025590 (1)
  • Ensembl_Trans:ENSDART00000102147 (1)
  • PROTEIN PRODUCTSNo links to external site
    ZEBRAFISH SUPPORTING SEQUENCES
    Type Accession # Length (bp/aa) Analysis
    RNA GenBank:AY293119 (1) 2661bp
    GenBank:EE684650 (1) 950bp
    GenBank:EE326370 (1) 867bp
    GenBank:EB884613 (1) 518bp
    GenBank:CK712469 (1) 190bp
    CITATIONS (2)