header logo image header logo text
Downloads Login
Research
General Information
ZIRC
ZFIN ID: ZDB-TSCRIPT-090929-8250
Transcript Name: snai1a-201
Previous Name: snai1a-002

Add new Alias

Alias
Attribution

Attributions for Alias: {{control.newAlias}}

{{pub.zdbID}}

Delete Alias:

(Including Attributions)
Transcript Type: mRNA
Annotation Status:
Strain: TU
Non Reference Strains:
Associated with Genes:
SEQUENCE
OTTDART00000025516 (1) [ Show ] (double-click sequence to select) [Download]
Select Analysis Tool
>tpe|OTTDART00000025516|OTTDARG00000020412|ZDB-GENE-990415-255 snai1a|OTTDARP00000020983 snai1a-002 LG_ CR555298.10 Danio rerio protein_coding KNOWN, 986 bp
AATTCAAAGTTGTACTTTCACGAACCACTTAAACCAAGCT
CATTCCAGACTCACGCTGACATCTGTTGAAAAGTGCATTG
TGCACTTGTCAGCTCATCAAAAGCAGCGTTCACGTTACGA
GAAGCACGGATTGGATCGTCGTTGCATTTCTGGGACTATC
TGAGAGTGGAGGATTTAGTTTTTCCATCACTGAAAGTAAC
TGGAGTGGACTGATCAACTTCAGAGTTCAGCATGCCTCGG
TCTTTCCTGGTAAAGAAGTATTTCACCAGCAAGAGGCCAA
ACTACAGCGAGCTGGAATGTCAGAACGACACTTCACCAGA
CAGATACCCGCTAGCAGAGCTTCCAGCAGTCAGCAATGAC
TTCCCAGTGACGTGTTTGACCACCGGACTGGTCTGGGACG
TCAGCTTGCTACCTTCCCTTCACAATTCCCCATCCCCGTC
CACCCTCTCCACAAACCAGGGCCCGCTGGACCTCAGCTCC
CCATCCAGCATCAGCTGCAGCAGCAGTGGGGAAGAAGATG
AAGGACGGACGTCAGACCCACCAAGCCCAGATTCCTCTGA
CACCTATCACCCCCAGCAAACTAGCAGGCCGCGACGCTCC
AACAAGAGCAGGGCTGGACAGAGAGAGGACAAGAGCGAGG
CTGCAGTTACTGCCGCCAGTCGACCAGCCTTCTTCTGCAA
GCACTGTCCTAAAGAGTACAACAGCCTCGGGGCGCTGAAG
ATGCACATCCGCTCCCACACACTGCCCTGCGTCTGTCCCA
CCTGCGGAAAGGCCTTCTCCAGACCCTGGCTGCTGAGGGG
ACACATTCGCACACATACAGGTGAGCGTCCGTTCTCCTGC
CCACACTGTAACCGTGCCTTCGCAGACCGCTCGAACCTCC
GCGCGCACCTGCAGACCCACGCAGATGTGAAGAAATACCA
GTGCAGCACCTGCTCTCGCACCTTCAGTCGCATGTCACTG
CTGCAGAAACACAGCGCGGCCGGTTG

snai1a TRANSCRIPTS
Type Name Length (bp) Analysis
mRNA snai1a-201 986
snai1a-202 (1) 1942
SEGMENT (CLONE AND PROBE) RELATIONSHIPS
snai1a-201 Contained in:
OTHER snai1a-201 TRANSCRIPT PAGES
  • Vega_Trans:OTTDART00000025516 (1)
  • Ensembl_Trans:ENSDART00000123567 (1)
  • PROTEIN PRODUCTSNo links to external site
    ZEBRAFISH SUPPORTING SEQUENCES
    Type Accession # Length (bp/aa) Analysis
    RNA GenBank:CN021726 (1) 950bp
    GenBank:CV114074 (1) 738bp
    GenBank:DT868624 (1) 737bp
    CITATIONS (2)