header logo image header logo text
Downloads Login
Research
General Information
ZIRC
ZFIN ID: ZDB-TSCRIPT-090929-8248
Transcript Name: fn1a-002
Previous Name: fn1-002

Add new Alias

Alias
Attribution

Attributions for Alias: {{control.newAlias}}

{{pub.zdbID}}

Delete Alias:

(Including Attributions)
Transcript Type: ncRNA
Annotation Status: retained intron
Strain: TU
Non Reference Strains:
Associated with Genes:
SEQUENCE
OTTDART00000025514 (1) [ Show ] (double-click sequence to select) [Download]
Select Analysis Tool
>tpe|OTTDART00000025514|OTTDARG00000020411|ZDB-GENE-000426-1 fn1a|no_translation fn1-002 LG_ BX323049.20 Danio rerio protein_coding KNOWN, 3022 bp
CGGCTGCGGACACTGAATCCCCGAGCCAATCAACTCCTCG
AGGAAACGAAGGGTTAACTTTTAGCGTGTTCAATCGCACC
TGTGAAAAAAATGTTTGGTGGCCCTTTGGGCACGGCGCTT
GCGGTGGCATTGCTTGCCTGCGCTGTGCAGTGTATGCCGA
AAGGAACGGGGAAACATAAAAGACAAGCTCAGGAACACTC
TGTATCATCTGTGTCACAAGATGGATGTGTTATGGACGGA
CAGTTTTATGGAGCTGGAGAGAAGTGGGAGCGCATTTATC
TGGGCAGCACGCTTCTTTGCACTTGTCATGGAGTTTCTAA
AATAGAGTGTAAATCAAAACCTGATGCTGAGGAGACCTGC
TACGATAAAGTCAATTCTCGTTCCTACCGGGTTGGAGAGA
CTTACGAGAGGCCCAAGGACGGAATGATCTGGGACTGTAC
TTGCATTGGCTCTGCCCGAGGGAAAATCAGTTGCACCATT
GCGAACCGCTGTCATGAGGGAGGGCACTCCTACAAGATTG
GAGACACATGGCAGAGACCTCATGACACTGGAGACTACAT
GCTGGAGTGTGTCTGCTTGGGAAATGGGAAGGGGGAGTGG
ACCTGTAAACCTGTTGCGGAGCGCTGTTATGATAATACAG
CTGGCACCTCCTACATGGTTGGTGAGACCTGGGAGAAGCC
CTACCAGGGCTGGATGATTGTGGACTGCACCTGCCTCGGA
GAAGGAAGTGGACGTATTACATGCACATCCAGAAACCGCT
GTAATGACCAGGACACACGCACTTCTTACCGGATTGGGGA
CACGTGGAGTAAGACGGACTCTCGTGGACACGTTTTACAG
TGTTTGTGTACTGGTAATGGACGTGGAGAGTGGAAGTGTG
AGAGGCATGCTTCTCTGCACACTACTAGTCTTGGTACTGG
GTCTCGTGTTGTGACCAATGTCCAGCCAGCAGTGTACCAC
CCACAAGGGGTGCCTGAACACCCTGTGGAGGGATCCTGTC
TGACTGAAGCAGGTGTTTCCTATGCTCCAGGCATGCGCTG
GAGCAAGGCTCAAGGTAGCAAGCAGATGTTGTGTACCTGC
TTAGGAAACGGTGTCAGCTGTGAAGAGTCAGAGAGTCAAT
CTCAGGTGTATGGCGGGACCTCAGGTGGCGAACCGTGTGC
TTTCCCTTTTGTGTTCATGGGGAAAACGTTTTACTCCTGC
ACGTCTGAGGGACGCAATGATGGACAGCTTTGGTGCAGCA
CCTCATCTGACTTTGAGAAAGACTACAAGTATTCCTTCTG
TACCAGCAACAATGTTGTGGTCACAACCAGAGGAGGAAAC
TCTAATGGTGCCCTGTGCCAGTTCCCTTTCCTCTACAATG
GCCGTAACTACACTGACTGCACTGCTGATGGCAGAAGAGA
TGGCATGAAATGGTGCGGCACGACTTATAACTTTGACAAA
GAGCAGCGCTTTGGCTTCTGTCCAATGGCAGCTCATGAAG
AGGTGTGTACCACCAATGAGGGTGTGATGTATCGTGTGGG
GGATCAATGGGACAGACGCCATGATGTTCTGGGTCACATG
ATGCGCTGTACGTGTGTGGGCAATGGCCGTGGAGAATGGA
GCTGCATCGCCTACTCTCAACTCAAAGACCAGTGCATAGT
GGATAATTTGACCTATGAAGTAAATCAGACTTTTACTAAA
AGGCACGACGAAGGCTACACAATGAACTGCACCTGTTTCG
GTCAAGGTCGTGGACGCTGGAAGTGTGATGCCATCGATCA
GTGCCAGGAGCCGGAGACTAGAGTTTTCTATCAGATTGGA
GAGTCCTGGGACAAACTCATTCAGGGAATCCACTACAGAT
GTTACTGCTATGGTAATGGCATCGGGGAGTTGAGCTGCGA
GCCTCAGCATTCTATCTCTGGTGGTCATCGTCCAGTCCAG
GTCATTATTTCAGAAGCTGGAAATCAGCCTAACTCGCACC
CCATCCAATGGAATGCACCAGCTTCTGCTCACATCACACA
GTACATACTTAAATGGAGGCCGAAAAACACCCATATTCAG
TGGATGGAGGTGACTATTCCAGGCCATGTCAACTCTTACA
CTATTGCGGGACTGAAGCCGGGAGTCACCTACGAGGGTCA
GCTCATCAGTATCCTGCGTTTTGGACGTAGAGAGACCACT
CGCTTTGATTTTTCCACCGTACATGGCTCATTGGAGACCT
CTGAGGGTGAGACCACCCAGCCCCCTCGAATGGTGGACAC
CTCTGAGTCAGTGACTGAAATCACCTCAAGCAGTTTCGTC
ATCTCCTGGGTGTCTGCGTCTGACACCGTGTCTGGTTTTA
GGGTGGAATATGAGCTGAGTGAAGAGGGAGGCCAGACTGG
ACAGCCCATGATCTTGGACCTCCCTCATAGCGCTACGTCC
GTGAACATCAGTGAACTTCTGCCAGGAAGGAAGTACACTG
TGAATGTATATGAAGTGACAGGAGAAGGAGAACCTAACCT
CATCCTCACCACTTCCCAGACTACTGCTCCTGATGCTCCT
TCTGATCATGAAGTGGAGGATGTAGCAGACACCTCCATTC
GTATCAGCTGGTCTAAACCTTTGGCTCCCATCACAGGTTA
CCGTGTAGTTTACACCCCATCTGAAGAGGGCAGTTCTGGC
AGTGTTGAGCTGAATCTGCCAGAACATTCCACCTCATTGA
CCCTTGGTGATCTTCGACCTGGTGTGCTTTATAACATCAG
CATCTTCTCTGTGGAAGAGAATCAGGAGAGTGAACCTGTT
TTTGTTCAGGTCACCACTGCTGGAGAGCCACTGGCGGGTA
ATCAACCACTAAAAATCATGAGAAAATTTCAAAACAGCAT
TCTATCTAATTATGTTTGAAAAATTACAATGTATTATGAT
AGTTTCATATATTTCCACCCCAAAATGTGTTTAGTTTAAT
GCATGTGACATTCACTTTTATTATTTTTTATCCATGTAAT
TTAAGAGCTCCTTAGTGCATTGTATCACCATTATAATTAT
GTACAATAATAGATTAAGAGAC

fn1a TRANSCRIPTS
Type Name Length (bp) Analysis
ncRNA fn1a-002 3022
mRNA fn1a-202 (1) 8776
SEGMENT (CLONE AND PROBE) RELATIONSHIPS
fn1a-002 Contained in:

OTHER fn1a-002 TRANSCRIPT PAGES
  • Vega_Trans:OTTDART00000025514 (1)
  • Ensembl_Trans:ENSDART00000103753 (1)
  • PROTEIN PRODUCTSNo links to external site
    ZEBRAFISH SUPPORTING SEQUENCES
    Type Accession # Length (bp/aa) Analysis
    RNA GenBank:AF081127 (1) 3145bp
    CITATIONS (2)