Transcript

ipo9-201

ID
ZDB-TSCRIPT-090929-8245
Name
ipo9-201
Previous Names
  • ipo9-001
Transcript Type
mRNA
Annotation Status
Associated With Genes
Strain
TU
Non Reference Strain
Genome Resources
RNA Central
None
Note
None
Sequence
OTTDART00000025511 (1) [ Show ] (double-click sequence to select) [Download]
>tpe|OTTDART00000025511|OTTDARG00000020409|ZDB-GENE-040426-2953 ipo9|OTTDARP00000020979 ipo9-001 LG_ CR628365.6 Danio rerio protein_coding KNOWN, 4947 bp
GTGCATTGGCGCGCTGTGCATCCTTCCGTCGGCTCCCCGG
TCATCTCTCCGTTAGCCTCGGCAAGACTGGCGAAAATATG
GCGGGTATGAGCGCGTCGGGCCCCGGCCCGGTTTCGAGTC
TCGACCAGGTGGATAAAGGATTGAAGGAGACTCTGATAGA
CGCGCTGAACGCCATTCTGTCCCCGGTGCAAGAAGTGCGA
GCGGCGGCGGAGGAGCGCATTAAAGTGCTGGAAGTGACGG
AGGAGTTTGGAGTTCACCTTGCAGAGCTCACAGTCGACCC
ACACGGAGCACTCGCTATTCGCCAATTGGCCTCTGTCATA
TTAAAGCAGTATGTCGAGACCCACTGGTGCGCCCAGTCAG
AAAAATACAGGCCTCCAGAGACGACAGAATGGGCCAAAGC
TGCGATCCGTGAGCTGTTGCCCAGTGGTTTGCGGGAGGCC
ATCAGTAAGGTACGCTCCAGCGTGGCCTACGCCCTTTCGG
CTATTGCACACTGGGACTGGCCTGAAGCTTGGCCTGGGCT
CTTCAAGCTCCTCATGGACATGCTGGCCAGTGGAGATGTC
AATGCTGTACACGGCGCCATGAGAGTCCTGACGGAATTTA
CTCGAGAGGTGACCGATGTGCAGATGCCGGATGTTGCTCC
TGTCATTTTGCCTCAGATGTACAAGATTTTTACCATGGCA
GAGGTTTATAGTATTCGCACTCGATCCAGAGCAGTTGAGA
TCTTTACAACATGTGCCAATCTCATCTGTGCGATTGATGA
AGTAGCAAAGGGTGCTGCCAACGCTCTGATTTTCCCTGTA
GTCCAGCAGTTTACAGAAGCCTTTATACAGGCCCTGCAGA
TCCCAGATGGTCCAACTTCCGATAGTGGCCTGAAGATGGA
AGTGCTAAAGGCAGTGACGGCATTGGTGAAGAACTTCCCC
AAACCCATGGTGTCCTCAATGCAACAGATTCTTCCTATTG
TGTGGAACACGCTGACAGAGAGTGCCTCTTTTTATGTGAG
AACTGAGGTCAACTACACAGAAGAAGTGGATGATCCAGTT
GACTCTGATGGTGAGGTCCTTGGCTTTGAAAACCTCGTCT
TCAGCATCTTTGAGTTTGTCCACACACTCTTGGAGAACAA
GAAGTTCAAGAGCACAGTGAAGAAAGCTTTACCGGAACTC
ATCTATTACATCATCCTCTACATGCAGATCACGGAGGATC
AGATCAAGGTGTGGACGGCCAACCCACAGCAGTTTGTCGA
GGATGAGGATGATGACACGTTCTCCTATTCGGTTCGGATA
TCAGCACAGGATCTGTTGCTGGCTGTTGCTGCTGAATTTC
AGAACGAGAGTGCTGCAGCTTTAGCGGCAGCCGCAACACG
ACACCTTCAGGAGGCAGAGCAAGCCAAGAACACTGGCAGT
GAACACTGGTGGAAGGTGCATGAAGCTTGCATGCTGGCGC
TGGGATCAGTCAAAACCATCATCACAGAGAATGTAAAGAA
TGGTCGTGTGCAGTTCGATATGCATGGATTTCTTGCCAAT
GTCATCCTCGCGGACCTCAATTTACCTGCAGCCTCTCCGT
TCCTGCTGGGTCGGGCCTTATGGGCAGCCAGTCGATTCAC
TGCAGCGATGTCTCCAGAGCTCATTCAGCAGTTCCTGCAG
GCCACCGTGAGCGGGTTACACGAAAGCCAGCCACCCTCTG
TTCGCATCTCTGCCGTCAGAGCTATCTGGGGTTACTGTGA
TCAGCTAAAGCTGTCAGAGAGCACTCACGTCCTCCAGCCA
TTCCTGCCCAGTGTTTTGGAAGGCCTGGTTCAGCTGGCGG
CTCAGTTCAGCTCTGAAGTGCTCACGTTAGTCATGGAGAC
CCTCTGTATTGTTTGCACTGTGGATCCAGCTTTCACTACG
AGTGCTGAGAACAAGATTTGCCCGCTCACCATTGCCATCT
TCCTCAAGTACAGTAATGATCCTGTCGTAGCATCTTTAGC
GCAGGACATCTTTAAGGAGCTTGCCCAGATTGAAGCCTGC
CAAGGACCCATGCAAATGCGCCTCATTCCTACTCTCGTTA
GCATTATGCAAGCGCCGCCTGATAAAATCCCTTCAGGACT
TTGTGCTACTTCCATAGATATCTTAACTACAGTTGTTCGC
AACACTAAACCTCCGCTCTCCGACATGTTGGTGTGCCAAG
CTTTTCCAGCAGTGGCTCAATGTACCCTCCGCACAGATGA
CAACACCACAATGCAGAATGGCGGTGAGTGCTTGCGGGCC
TATGTGTCTGTGGCGCTGGAGCAGATCGCCCGATGGCAGG
ATGAGCAAGGTCACAGTGGGCTGTGGTATGTCATGCAGGT
TGTCAGTCAGCTCCTGGACCCCCGCACATCTGAGTTCACC
GCTGCTTTTGTGGGTCGTTTGGTGTCCACTCTTATTACCC
GAGCTGGCACTCAGTTGGCTGACCAGCTGGACCAAATACT
GCGTGCTATTCTCAGCAAGATGCAGCAGGCTGAGACACTC
AGTGTGATGCAGTCCCTGATTATGGTTTTCGCCCACCTGG
TCCATTCCCAGTTGGAGCCCCTGCTGGAATTCCTATGCAG
TCTTCCAGGTCCCACAGGGAAACCGGCCCTGGAGTTTGTC
ATGGCTGAGTGGATGAGTCGCCAGCATCTGTTCTACGGCC
AGTATGAAGGCAAAGTCAGTGCTGTCGCCTTGTGTAAACT
TCTCCAGCACGGTCTGAATACAAATGACAAGCGCCTCCAA
GATATAGTCGTCAAAGGAGATGAAATTTTTAATCCAGACG
AGGGAATTTGCACACGTTCCAAATCAGCCAAGAATCCTCA
GCGGTGGACCAACATTCCTTTGCTGGTCAAGATCTTTAAA
CTTATCGTCAACGAACTCTCTTCTGTGGTAGAGGCTAATG
CAAACAGAGCAAATCCTGCAGACTGGAGCCAAGACTCTGG
TGGAATGTGGGATGATCTGGCGGAAGAAGAGGATGAGGAA
GAGGAAGATGAAGGACTAGCCGGACAGCTTCTGTCTGATC
TTATTGCTTCCAACAAATATGATGATGATTATTATGAGGA
TGATGATGATGAAGATCCAGATGCTCTGAAGGATCCGATA
TTTCAAATTGACCTTCAGGCTTATCTGACAGATTTCCTGA
CCCAGTTTGCTCAGCAGCCTTGCTATAGCATGTTTTCCAG
CCACTTAAATGAGGTCGAGAGAAGAGTCTTGCAGTCCATA
GGTATTTGAGCTGTATCCCAAATTCCAACATCGGCTCCTT
GTCCTTTGTTTCCGTCTTTACCACTCAGTCATCTTTTTTT
TTTTTCAAACTTGAACATTTGAGTGGCATTTCGGACGACG
CTCTCGACCCACAAGCCAAAAGAGGACTAAAGTAAAGGTT
TACGTGTCTCTCCCTGTGTTTTATTAAGGGAAGGGATGGA
CATTGAGTCTTTGGGATGTTATAAGAGCAGGGTGTGATGT
GCTTTTTTTTGCATCCCAGACCTGACCGAATGGGTACATT
TGAATCGGAGTTCAAAACACTACTGTGCTTTGATTGACCC
GTCTGGTATGATGAATGAATTTTTCTGCAATGGGACTGGA
AATGGTATAGGAACGATTTAAAAGTATGAACTGTCCATTT
ATACCTTCTCGCTTTATTAAGTCACAATGGTTACATAATC
TTTCTGTAGAGGAAGGTAAAAAGACTTATGATGACAGATG
ATGAATCTGAACTTTGAAAAGAAGTTGGAACTGTTGGCGG
CCTTATTAAAATTATCCATGTTGTTTGTCATTATGTGGTC
TCACGAGCATGATCTTTATAGCTGCACTGTGTTGGGTAAG
CATGAAGAATCATAGTGTTATCGTGGTGATTCTAGACTTA
TTAACACTGTAGTATGAGAACACTTTCCAAATAAAAGGCC
TGGTAAGGTCTCATTTGTAATTGTATCTAGTTTTTGGAAA
ACTTAAGACATCTGTATGACAGTATTTTTACTGTAAAATG
ATAAAAATGTTAGTAACTGCCCTTAGAATTAATATACAAT
TTACAACTACTACCTTCAAATTATGATAATTGTACTTAGT
GACTGTAGAAACGTGTTAGATTACACATTTTAGGTAATAT
AAGCAATTAATTTTGACCTTATTTATCATATGGATTTGAA
TAGAGTTATAGATATTATAGATAGATATTTTTTCCTGTTA
ATAATATTTCTAAAGGAGCTGTTGACAAGGAATTAAACCT
GATTTTGGTAAAAACCCAAACAATACAAACACAAAAATAA
AACAAAACAACTATTAAAAACGTTGGACTCAAGCACCTAA
TATGAATTTACAATGATAAAGGGCAGAGTTGCTGAAGAAC
TACTGTATGATTTCAGCTGCTGTCTGGGCTTTTTATGCAT
TTCTACACCTCACTTTCTTCATGTGTTCAATACTTTTTCT
CAGTGTCATTTCCTTTTATTAGGAATAACTTAATTTGTAA
ACTAATTAGATTTGTTTTCTTTGCATATATGGATTTCTTT
GGTTGTTACCAATATCTGGGAAAAATTTCAAGTCAATAGC
ACCTTTAGAAATATGTTTTGTGAGAAAAATGGTGGCGTGT
TCAATACTAATTTTCTCCACTGTACACTATATTGGATAAA
CAAAAAATAGAAAAAGGAACATTAAATCCGTTTTTTATCA
AGATGAAGTGTATTAAACCTTGCATTACATTGGTATTTCC
CAAACGTGTTTGTAAGTTGATGAAAAAAGTTCAATTATTA
CAATGTAAAATTAAAATAAGGATATCTTTTTTTTTATTTT
ATTTTTTTTACCTCAATGTTGTATGGTCATCAGAAAACTT
TGAATATGCAAATATGTTGAACTTCAGGCAACTGAAATTC
CAGGTGTACCTTAAGTATATATTTCAGATGCAATGGGTTT
AGCCCAACAGCAGCAAAGAATCCATGCATTGCTTGAACAA
ACGTTAATAAACATGAATATGAAATTA

Segment Relationships
Protein Products
No data available
Supporting Sequences
Citations