ZFIN ID: ZDB-TSCRIPT-090929-7792
Transcript Name: mettl3-201
Previous Name: mettl3-001

Add new Alias

Alias
Attribution

Attributions for Alias: {{control.newAlias}}

{{pub.zdbID}}

Delete Alias:

(Including Attributions)
Transcript Type: mRNA
Annotation Status:
Strain: TU
Non Reference Strains:
Associated with Genes:
SEQUENCE
OTTDART00000025016 (1) [ Show ] (double-click sequence to select) [Download]
Select Analysis Tool
>tpe|OTTDART00000025016|OTTDARG00000020116|ZDB-GENE-030131-9498 mettl3|OTTDARP00000020598 DKEY-85K7.2-001 LG_ BX005336.10 Danio rerio protein_coding KNOWN, 2003 bp
ATAGAAACAGTTTAGCGGCACGGTGTGTATGGTGGTACAG
TCACTCAGCGTTAGTTTGCTAGATGTAATCTAAACTTCAT
AAAACCCCTGTTTAATCAGTACTGTTTGTTTATTTGCTGT
TTAGCTCGTTTAATTTAAGCCATGTCGGACACATGGAGTC
ACATCCAGGCGCACAAAAAGCAGCTGGATTCACTACGAGA
GAGGCTGCAGAGGAGAAGAAAAGACCCAACTCAACTGGGC
ACTGAGGTTGGAAGTGTTGAGAGTGGATCTGCAAGAAGTG
ACAGCCCGGGACCAGCAATTCAGAGTCCTCCACAAGTAGA
AGTTGAGCATCCTCCAGACCCAGAGCTAGAGAAGAGGCTG
CTGGGATACCTCTCTGAACTGAGCCTTTCCCTGCCAACTG
ATTCCCTAACGATCACCAACCAGCTAAATACATCTGAGTC
TCCAGTTTCCCATTCCTGCATTCAAAGTCTCCTTCTTAAA
TTTTCTGCTCAAGAGCTTATTGAAGTTCGGCAGCCATCCA
TCACCTCCTCTTCGTCCTCCACCCTCGTCACGTCAGTCGA
CCATACCAAACTATGGGCTATGATTGGCAGCGCAGGCCAG
TCACAGAGAACTGCCGTTAAAAGGAAAGCAGACGACATCA
CTCATCAAAAAAGAGCCCTGGGCTCCTCCCCTTCGATTCA
AGCACCGCCTTCTCCTCCAAGGAAATCCTCAGTCTCATTG
GCTACTGCCTCAATCTCGCAACTCACTGCATCCTCTGGGG
GAGGAGGGGGTGGAGCTGATAAAAAGGGGCGGAGCAATAA
GGTGCAAGCATCTCACCTGGATATGGAGATTGAAAGTCTA
CTGAGCCAGCAATCCACTAAGGAACAGCAAAGCAAAAAGG
TGAGCCAAGAGATCCTAGAGCTGCTGAATACCAGTTCAGC
AAAAGAACAGTCGATTGTGGAGAAGTTTCGCTCACGAGGC
AGAGCTCAAGTTCAGGAGTTCTGTGATTATGGAACCAAAG
AAGAGTGTGTGCAGTCGGGGGACACTCCTCAGCCCTGCAC
CAAGCTGCACTTCAGGCGAATCATCAACAAACACACAGAT
GAGAGCCTTGGCGACTGCTCCTTTCTAAACACTTGCTTCC
ACATGGACACCTGTAAATATGTGCACTATGAGATTGACAG
TCCTCCTGAAGCAGAGGGAGATGCACTGGGGCCACAGGCA
GGGGCAGCTGAGCTTGGGCTGCACTCTACTGTGGGAGACA
GCAATGTGGGCAAGCTGTTTCCTTCCCAGTGGATTTGCTG
TGACATTCGTTATCTGGATGTGTCCATCCTGGGGAAGTTT
GCAGTGGTGATGGCTGACCCGCCGTGGGATATTCACATGG
AGCTTCCCTACGGAACACTCACAGATGACGAGATGAGGAA
GCTCAACATTCCTATTCTGCAGGACGACGGTTTCCTCTTC
CTCTGGGTGACAGGAAGGGCTATGGAGCTAGGCAGAGAGT
GTTTAAGCTTATGGGGCTATGATCGTGTAGATGAAATTAT
CTGGGTGAAAACCAACCAGCTCCAGAGAATCATTCGTACT
GGAAGGACTGGACATTGGCTGAATCATGGCAAAGAGCATT
GCTTGGTTGGAGTGAAAGGAAACCCACAAGGATTTAATCG
AGGCCTTGACTGTGATGTTATAGTGGCAGAGGTCCGTTCC
ACTAGCCATAAACCAGATGAGATCTATGGAATGATTGAGC
GCCTGTCTCCAGGCACACGAAAGATTGAATTGTTTGGCAG
GCCACACAATGTACAACCTAACTGGATAACTCTTGGTAAT
CAGCTGGACGGCATTCACCTTTTAGATCCGGAAGTTGTTG
CTCGTTTTAAGAAACGCTACCCTGATGGAGTCATTTCTAA
GCCTAAAAACATGTAAGAACTGGGCTAGTGGGAGAACACA
CTGTTGGTTAAACTCAAGACTTATTGATGCTTTCTAGTTA
CTTTTGTACTACATTTCTTTTGTAATAAAATCGATGAAAC
ACA

mettl3 TRANSCRIPTS
Type Name Length (bp) Analysis
ncRNA mettl3-002 (1) 684
mRNA mettl3-201 1997
SEGMENT (CLONE AND PROBE) RELATIONSHIPS
mettl3-201 Contained in:
OTHER mettl3-201 TRANSCRIPT PAGES
  • Vega_Trans:OTTDART00000025016 (1)
  • Ensembl_Trans:ENSDART00000019699 (1)
  • PROTEIN PRODUCTSNo links to external site
    ZEBRAFISH SUPPORTING SEQUENCES
    Type Accession # Length (bp/aa) Analysis
    RNA GenBank:BC067182 (1) 1987bp
    GenBank:CN015555 (1) 929bp
    GenBank:CO958882 (1) 795bp
    CITATIONS (2)