header logo image header logo text
Downloads Login
Research
General Information
ZIRC
ZFIN ID: ZDB-TSCRIPT-090929-7784
Transcript Name: lft2-201
Previous Name: lft2-001

Add new Alias

Alias
Attribution

Attributions for Alias: {{control.newAlias}}

{{pub.zdbID}}

Delete Alias:

(Including Attributions)
Transcript Type: mRNA
Annotation Status:
Strain: TU
Non Reference Strains:
Associated with Genes:
SEQUENCE
OTTDART00000025008 (1) [ Show ] (double-click sequence to select) [Download]
Select Analysis Tool
>tpe|OTTDART00000025008|OTTDARG00000020110|ZDB-GENE-990630-11 lft2|OTTDARP00000020592 lft2-001 LG_ BX248131.6 Danio rerio protein_coding KNOWN, 1318 bp
ATTCATTCTTTCACTGGCATCGTTAGATCAGTCATGGCTC
TGTTCATCCAGCTGTTCATTTTGACCACAGCGATCTCACT
CACACAGGGATTCCAGCATGAGGACATCAAGCAGGCTCTA
CTCCAAAAACTCGGACTAACTGAACCGCCCAGGATCCAGA
AGCGGGATTTGGAGAATTTAGTTGTCCCGGCTCACATTAA
GAGCAAGTATCTGTCCATGCTGAAGCTCCATCACCAGCGC
AGGAGGAGATCTCTGCCCAGCCTGGCAGGAATACTCAGGG
GAATACACGGCAATGCAGATATTACCGGAGAAATCAAGTA
CTCGGACACCACCCGTCAGCGTCTTGTGTTCGACATGGAG
GCCAGACTTCAGGAAAACACCGAAGTCACGATGGCCGAAC
TGAAGCTCTTCCAGACCGCGGCTCAGAGTCCGTCCAAGCC
GGAGCGGAGGCACCACAGGCCGATAAACCACGCCAGAGTC
AGCATCTACTGGGTGGAGGTGCTGGAAAACGGCTCCAATA
GAACATCACTCCTAGACTCACGACTGGTTCCCATTCACGA
GTCGGGCTGGAGGAGCTTCGACGTGACCCAGGCCATTCAT
TACTGGTCTAAATCCCAAAAGAAAGCACCTCTGCATCTGG
AAGTGTGGACTGAGGGAGAGAGACCCGGGAGTTATGCGGC
TGAAATGGCCAAAAGAGTGCGCTTCGCCACACAGGATCCA
AAGGGAAACACCCTGGAGAAGGACATGGGCGCACCAGAAC
TTGTGCTTTACACTTTAGACCTCGATGAATATGGATCCCA
AGGCAACTGTAACTCCAGCCCAAACAGCAGCAAATGTTGT
CGGGAGGAGCATTTCATCAACTTCCGTGAGCTCACCTGGA
CTCAGTACTGGATCATTGAGCCGGCCGGGTACCAGGCGTT
CAGGTGCGCTGGAGGATGCAAGCAGCCCAAACGTGGTTTC
TATGGATATGGACAGAGGACATGTGCAGTGATGGAGAGCG
CGCCGCTGCCCATGATGTACCTGGTCAAAAAGGGAGATTA
CACTGAAATCGAGGTGGCAGAATTCCCTAATATGATTGTG
GAGAAGTGTGGATGCTCCATGGACAAAATCCCTCCAGTCT
GACAGTGTGGTGTCGAATAGTTTGCTCTCAGATGAGAGGT
GACGTGTTTAATAATCACAGTTATGGGACTCCCCAAATCC
CCACTGAGCACTTGAAAAACAAAGTATTTATGAATTATTG
CTTTATGTAATGTAAGCTTTAGAAATGGCTTGTTGAGAGA
TGTGATGTTTGAAAAATAAAGTAAGTAGCTTAATTTTA

GBrowse:
SEGMENT (CLONE AND PROBE) RELATIONSHIPS
lft2-201 Contained in:

OTHER lft2-201 TRANSCRIPT PAGES
  • Vega_Trans:OTTDART00000025008 (1)
  • Ensembl_Trans:ENSDART00000064678 (1)
  • PROTEIN PRODUCTS No links to external site
    ZEBRAFISH SUPPORTING SEQUENCES
    Type Accession # Length (bp/aa) Analysis
    RNA GenBank:BC097092 (1) 1336 bp
    GenBank:AF132445 (1) 1315 bp
    GenBank:BI704264 (1) 873 bp
    GenBank:CV486208 (1) 773 bp
    GenBank:CV486211 (1) 705 bp
    CITATIONS (2)