ZFIN ID: ZDB-TSCRIPT-090929-7590
Transcript Name: prl-201
Previous Name: prl-001

Add new Alias

Alias
Attribution

Attributions for Alias: {{control.newAlias}}

{{pub.zdbID}}

Delete Alias:

(Including Attributions)
Transcript Type: mRNA
Annotation Status:
Strain: TU
Non Reference Strains:
Associated with Genes:
SEQUENCE
OTTDART00000024794 (1) [ Show ] (double-click sequence to select) [Download]
Select Analysis Tool
>tpe|OTTDART00000024794|OTTDARG00000019973|ZDB-GENE-030513-1 prl|OTTDARP00000020433 prl-001 LG_ BX511021.9 Danio rerio protein_coding KNOWN, 1399 bp
GGAAAGAGGACCACACAGATTCACGCAAGAAAATAAAGAA
ACCTGTTCTAGTAATGGCTCAAGGGTCTAGACTATACTTT
GCAGTGGCTTTTTTGATGTGTGCATTTGTCTCCATCAATG
GTGTGGGTCTGAATGATTTGCTGGATAGAGCTTCTCAACT
TTCAGACAAGCTTCACTATCTCAGCACCTCACTCACCAAT
GATCTGGATTCTCACTTCCCTCCTATTGGAAGGGGAATGA
TGCCGCGCCCATCCTTATGCCACACGTCATCTCTTCAAAT
CCCCAATGACAAAGACCAAGCCATGAAAGTGCCGGAGGAT
GAGCTGTTGTCATTGGCTCGGTCTCTGCTGTTGGCTTGGT
CTGATCCGCTCGCCCTGCTCTCCTCTGAGGCGTCCAGTCT
GGCACATCCAGAACGCAACACCATTAACAGCAAGACCAAA
GAGCTGCAGGACAACATCAACAGTCTGGGAGCAGGCCTGG
AGCACGTCGTACACAAGATGGGCTCGTCTTCTGACAACCT
GTCCACTCTCCCGTTTAATGGCAATAACCTTGGTCAGGAT
AAAACGTCTCGACTTGTCAATTTCCACTTCCTGCTGTCCT
GCTTCCGCAGAGACTCCCACAAAATTGACAGTTTTCTCAA
AGTCCTCCGCTGTCGGGCAGCCAAGAAGAGGCCTGACATG
TGCTAGAGTGAAAACACTGCTCTCTGCTGCTCTCGGTGTG
AATGCTAATTTAAAATGACAGCAGAGAGTGCTTCAGAGTG
ATTCATTACAATCACATGGCAAAATATACCCTCTTTATTG
TTTGTTTGGAAGATGTAGATATTTCATTTAATATATACTT
GATTATACTTCTTATATACTTGCATACATATACATATTAA
ATAAATTACATAAATATAAATATTGTACTGCACTGTCCCC
ATAGATAAAATTTAATTTTAAAACGATAAAATAAATGACT
CCTTAAAACATCTGCATGTGATAATACTGTATCGTTACCT
TGAAATTATAAGGATCCATCTGCGTTCTGATTGATTTTGA
GATATTGAGCTTTTAAGTTTTTGCAGTCCATAGCACACAT
ATGTGTGTAACAATTGTTTTTCAAATAAAAAGTCTTAAAA
TTCAAACAACTTAAAAAAAAAATCCTATAATGTAAATAAG
TTGTCAAATAATAGGAATATGTCAATAACCTAATTTTGAC
AAAAATGGATGATAGAACCTTATAATTCTAAGGTAAGTTC
TGACCGCAGTTTGATAAGACATTTGTAGGCCTATATTAAG
TGACTAAAATGTATTTATTATGAAAATAATCTTAAGCGCA
TGTATTTTAACATTGTTTTCTTTAATGTGATATTTAAAGC
TCTGCACCAATGACAATAAACTTCTATCATGCATGTTCA

GBrowse:
SEGMENT (CLONE AND PROBE) RELATIONSHIPS
prl-201 Contained in:
OTHER prl-201 TRANSCRIPT PAGES
  • Vega_Trans:OTTDART00000024794 (1)
  • Ensembl_Trans:ENSDART00000055299 (1)
  • PROTEIN PRODUCTSNo links to external site
    ZEBRAFISH SUPPORTING SEQUENCES
    Type Accession # Length (bp/aa) Analysis
    RNA GenBank:BC092358 (1) 1425bp
    GenBank:AY135149 (1) 1396bp
    CITATIONS (2)