header logo image header logo text
Downloads Login
Research
General Information
ZIRC
ZFIN ID: ZDB-TSCRIPT-090929-7587
Transcript Name: kcnh6a-202
Previous Names: kcnh2-001, kcnh6-001, kcnh6a-001

Add new Alias

Alias
Attribution

Attributions for Alias: {{control.newAlias}}

{{pub.zdbID}}

Delete Alias:

(Including Attributions)
Transcript Type: mRNA
Annotation Status:
Strain: TU
Non Reference Strains:
Associated with Genes:
SEQUENCE
OTTDART00000024790 (1) [ Show ] (double-click sequence to select) [Download]
Select Analysis Tool
>tpe|OTTDART00000024790|OTTDARG00000019970|ZDB-GENE-040702-5 kcnh6a|OTTDARP00000020429 kcnh2-001 LG_none CU062431.6,BX324157.4 Danio rerio protein_coding KNOWN, 4931 bp
AGTACCATTAAACCACAATGAGCTCCAGCAGCCGCGCCGC
ATCTGAGGTGTCGGTCTTCAGCTCTGCTGCGTTGCGTTTT
CTTCTATAGTGGTTTCAGAATATGTAACGTCTGGTTTCGG
GAAACACATGCGTGCGTTTCCACTGCGCGGAGCAACATCT
GAGTTTCGAGCCTCATAACTGCACGGCGCTTGTTTTCATT
CAAACTCGTTTCCTTTTATTTGCATCTCTACTCGGCGACT
TCACACTTTCGCGAAGGTTCCACTGGAGACGCGTGTTTTT
ATTTATTTAGTATTATGTTTTGCTCAATTCCTCGGTCGTA
AACACCTGTTTCCTCCACAATGCGCAAGAGTTCTAGATTA
TCTTCTTTTGTTTTGCTTGGCCGTCCTTGAACGAGACTGA
AAACCAGAATAAGAGGGCTCTTGAATCTGTCCACGCGTGA
AAAATGCCCGTGCGCCGCGGACATGTCGCTCTCCAGAACA
CCTATCTGGACACCATCATTAGGAAATTCGACGGGCAAAA
TCGTAAATTCTTGATCGCAAACGCCCAGATGAAGAACTGT
GGAATCATTTACTGCAATGAGGGCTTTTGTCAGATGTTTG
GCTTCTCGCGGGCGGAGATCATGCAGCAGTCCTGCACGTG
TCAGTTTCTGGTGGGGCCGGGCACTATGAAGAGCGCCCTG
GGACAGCTGGCACAGGCTCTGCTCGGGTCAGAGGAGCGCA
AAGTGGAGATCCTCTACTACTCTAAAGAAGGGACTTGTAG
GCCGTGTTTGATTGATGTCATTCCGGTAAAGAATGAGGAA
GGAGTTGTGATCATGTTCATCCTAAACTTCCAGGAACTTT
TAGACCCATCCATGAAGAAAGGTGGTCTGAAACAGCGCAT
GGCGAACAGCTGGCTGCGGGCAGGTCAGCGACGCAGGATG
CATCTGAGAATGCCTTCTCTCCGTGTCAAAAGGCAGCCGT
CTCTTCCTAAAGACCACTTTGAGGGAGTAGTGGTGGATTA
CCTACAGCCGTCTCATGAGGAGGTGGCCCTCAAAGATCTC
CAGATGTCTCCAGACAGCTGTTTAAAGTCAGAGACGCAGG
CCTTGATTCAGCAGACCCCATCCTCCTGCGAACTCTCACC
GCCACCCTCACGGCCCTCAGACCGACTGGAGCCAAGTGGA
CCCCTTCTCAAACATAGCCACTCCAGAGAGAGCATGCACA
GCCTGCGCCGGGCATCCTCGCTGCACGACATCGACGGCAT
GAGGGACCAGTGGAGCGATCTAAAGCCCAGTAATTTGAAC
TCCACATCAGACTCTGATTTGATGCGGCACCGCACAATTG
GCCGCATCCCTCAGGTGACGATATCCTTCGGCTCGGACCG
CCTCAGACCACCTTCCCCTACTGAGATCGAAATCATCGCA
CCCAGCAAGATTAAAGACCGCTCACAGAACGTCTCAGAAA
AGGTCACTCAAGTTACGCAGGTCCTGTCACTCGGGGCAGA
TGTGCTTCCGGAGTACAAGCTTCAAGCTCCCCGCATCCAC
AAATGGACAATCCTGCACTACAGCCCGTTCAAGGCGGTGT
GGGACTGGATCATCCTGCTGCTGGTGCTCTACACGGCCGT
CTTCACGCCATATTCAGCCGCGTTCCTCCTCAACGAGCAG
GAGGATGAGAGAAGACGCACCTGTGGCTACACCTGCAACC
CTCTGAACGTGGTGGACCTGGTGGTGGACGTCATGTTCAT
CATCGACATCCTCATCAACTTCAGGACCACATACGTCAAT
CACAACGACGAGGTGGTCAGCAACCCTGCCCGCATCGCTC
AGCACTACTTCAAGGGCTGGTTCCTCATAGACATAGTTGC
TGCCATCCCCTTCGACCTGCTCATTTTCAGATCCGGTTCA
GATGAGCCTCAAACCACCACTCTGATTGGTCTGCTGAAGA
CTGCACGGCTGCTGCGACTGGTGCGAGTAGCGAGAAAACT
GGACCGTTACTCTGAGTATGGAGCGGCGGTGCTCTTCCTC
CTCATGTGCACCTTTGCTCTCATCGCCCACTGGCTGGCAT
GCATCTGGTACGCCATTGGCAATATGGAGCGCACCAGCTC
TGCCCGCATAGGAGGCATGAAGATCGGCTGGCTGGACAAC
TTAGCTGACCAAATTGGCAAGCAGTACAATGACAGCAACA
GTTTCTCTGGCCCCTCCATCAAGGACAAATATGTTACTGC
ATTGTACTTCACCTTCAGTAGCTTGACCAGTGTGGGCTTC
GGAAATGTCTCTCCAAACACCAACCCTGAGAAGATTTTCT
CCATTTGCGTCATGCTTATTGGCTCTCTGATGTATGCCAG
TATCTTTGGCAATGTGTCTGCTATCATTCAGAGGTTGTAT
TCTGGCACAGCACGGTACCACACTCAGATGCTCCGTGTGA
AAGAGTTCATCAGATTTCATCAGATCCCAGGTGGCCTTCG
GCAAAGACTAGAGGAGTATTTCCAGCATGCCTGGTCCTAC
ACCAACGGCATCGACATGAACGCTGTGCTGAAGGGTTTTC
CAGAGTGTCTACAGGCTGACATCTGTCTTCATCTGAACCG
CAGTCTGCTTCAAAACTGTAAGGCATTTCGAGGGGCAAGT
AAGGGCTGTCTACGGGCTCTGGCCATGCGCTTTAGGACCA
CTCATGCCCCTCCCGGCGACACTCTGGTTCACAGTGGAGA
CGTACTGACCGCACTCTACTTCATCTCCCGTGGCTCCATA
GAGATCCTCAGAGACGATGTGGTCGTGGCCATTTTAGGTA
AGAATGACATTTTCGGGGAGCCCATCAGTCTATATGCCAG
GCCGGGGAAGTCAAGCGCTGATGTGAGGGCTCTGACATAC
TGTGACCTGCATAAGATCCTGAGGGACGACCTGCTGGAGG
TGCTGGACATGTACCCCGATTTCTCCGACAACTTCTGGAG
CAACTTGGAGATCACGTTCAACCTTCGAGATGTAGACAGA
ATCATGCACCCAACACCAAGCGAGGACTCAGATTGTGGGT
ACAGGCGGCCCAGACACCGGAGGAACCCCCTACGGCGAAA
TCGACCTGATGGGATGGACCGGGATGGGATGGACACATAC
CCAGTCCAGCCCTGTTCTCCTGTGGGGAACCACCGGGGGG
CGATACCGCTGTCACAGTGGGATGAGTTGTGTAGTGATGG
CAGCCCTGCTTCTCTCTCCAGTGAAGAGGATATGAAGCCT
CTGGTGTCCGGCCAGGGGGATATGTACTCACTGGGCACAG
AGATGCAGGAATTCTCCCCTTCTGCAGTCAGTCTTATGCC
CTCCGCCCACAGCACTGCTTCTGCCATGGCTGGACCGCTG
ACAGGTGCACATCAGTACACAGCAGCCCCTCTGAACATTT
CAGGGGTATACAGCTATTTGTCGGACCGCAGGGCCAGTGA
GTACTCAGAGAGTCAGAGACGTTCCTCTGCGGTGCAGGCA
TGCTATCACCATCACAGCCCCTGTGTGGGGGACAGACCGA
ATCAACTACAGGCCCGTCTGGAGCTGCTGCAGTCACAACT
CAACAGACTGGAGACCAGGATGACGGCTGATATAAATGTG
ATCCTGCAGCTGCTGCAGAGGCAGATGGCACCTGTTCCTC
CAGCCTACAGTGCCGTTTCTCCTGATCCACTCGCACACCC
AGCCCCCCCAGCCCACCCCACCAGCCTCTACACTACAGCA
GCACACAACACCACACCCTCCCTACAGATCACTGACGCTT
CTTCACCTGGAAAGTCCTGACGTGGACAGCTTGAAAGAGA
AGTCTCCAGACTCTCTGTCCAGCGGGATTCATCTGACGGT
GGCTTCCACTGACACCATGTCCATGTCTCCAGAGACAGAG
CTGTCTGTGCCCTCTGCTGGGCCTCTTCTCCAGCCTCCAG
GCCTGCTGTGCAGTAGCCTGCGCTTCCCGTCACTCCCAGA
CAGCCTGGAGGGTCCTGGCACACTGGAGGGGTCACCCGAA
ATCCAAAGGCACGTGTCCGATCCAGTCTTACCCGGAAGCT
AGAGGCTAAAAAGCAGACTATTGTTCATTCTGAGACTCAT
TTACTCCACGGTTTCCAATATTGCACTTTTGCAACAAAAT
GTATTCATTAGGACGTCCGTTAGAGCAAACGAGCCGATTT
CTTTGAATCTCTGAGGTTTGTCTCATATCCCTTCTCACTA
AGAGCAGGAAGTTCTCTTCTGTCGCGACAGTATTTGGTAA
CTTTTGTTTGCAACCGAATATGACAAAAAGCGCAGTGGGC
AATAAAGACGAGATCCAAGAGTCAAAGAGAGATGCCACAT
TACAGTTCACCCGCCTCCATCTTGTTTGTTTGTGTCTAGT
TTGAAATTGTCCTCCTAGTCTAAACCTCATTTTTTTGTCT
GCTTTTGTCAAACTAAGATTCACAGGACAGATTCACTAAA
GTAGAACAAAAAAATGTTCAAAGTTTTTCTTTTCAGTGTG
TACATTTTCTAATTCTATATATTTTGTGTGTGGTTAGCTG
TTTGACCCAAATCTAATGTGTTACTGCATCAGCTTTATGA
CTGGCACCAAATGAATCTGTGTGTTTGGATTCATTGTAAC
CAAATGTGCTTGAATTCAGGGTTATGAAATGATTTTCCTC
ACTGAAGTGTGACTGACTGAGTGTCTGTGTGTGTGTGTGT
GAGTGTAGATTTATGATGTGTGATCTTTTTGGAAATGTGA
TTTTGAATATGATAAAGAAAAACATTCAGGCTTAAAGGAT
TTGGAGTTCTCAAGGTTTTGGATGGAAGAAAGTGAAGGAC
TGTTTTTGTAAATCACTGTTGAGATGAAATCAGTGTAAAG
ATCATTTCACCTCTGAAATAGAAGCAGATGAATGTAAAAT
GATTGGAAGCCTTTATTGGACTGTAAAGGTTTCCAAATGC
ACACAACTGTTATTATTATAATTATTTTTTAGATTAAATG
TTATTTATAAA

GBrowse:
SEGMENT (CLONE AND PROBE) RELATIONSHIPS
kcnh6a-202 Contained in:

OTHER kcnh6a-202 TRANSCRIPT PAGES
  • Vega_Trans:OTTDART00000024790 (1)
  • Ensembl_Trans:ENSDART00000134201 (1)
  • PROTEIN PRODUCTS No links to external site
    ZEBRAFISH SUPPORTING SEQUENCES
    Type Accession # Length (bp/aa) Analysis
    RNA GenBank:AF532865 (1) 4591 bp
    GenBank:BC163642 (1) 3874 bp
    GenBank:EE318014 (1) 862 bp
    GenBank:EB936530 (1) 622 bp
    GenBank:FP110029 (1) 582 bp
    GenBank:EB779932 (1) 560 bp
    GenBank:CT638106 (1) 534 bp
    GenBank:EB936398 (1) 439 bp
    CITATIONS (2)