Transcript

elob-201

ID
ZDB-TSCRIPT-090929-7556
Name
elob-201
Previous Names
  • tceb2-002
Transcript Type
mRNA
Annotation Status
Associated With Genes
Strain
TU
Non Reference Strain
Genome Resources
RNACentral
Note
None
Sequence
OTTDART00000024745 (1) [ Show ] (double-click sequence to select) [Download]
>tpe|OTTDART00000024745|OTTDARG00000041041|ZDB-GENE-020415-1 tceb2|OTTDARP00000020406 tceb2-002 LG_ BX004999.8 Danio rerio protein_coding KNOWN, 1715 bp
ATCTGCTTTTCTTTTCATTCTTTTATTGGAGAAAACAGCG
GTGGTTTTACTTGTAAATTTCGAAAACAACGTTTTTTTTA
CTATTTATTCTCAATTGATGTCTTTTTGATGATCAGACGT
CACAAGACAACCATCTTTACAGATGCTAAGGAGTCTACCA
CAGTCTATGAGCTGAAGCGGATTGTGGAGGGCATTCTGAA
GCGAGCACCGGAAGATCAGAGGCTCTATAAGGATGACATG
CTGTTAGAAGATAGTAAGACTCTTGGAGACTGTGGATTCA
CAAACCAGACAGCCAGACCTCAGGCTCCAGCCACAGTAGG
ACTGGCTTTTCGCATCAGCGATGATGCTTTTGAGCCTCTA
AGAATAGAGGCCTTCTCCAGCCCTCCTGAGCTTCCTGATG
TTATGAAGCCTCAAGACTCGGGCAGCACCGCCAACGAACA
AGCCGTGCAGTGAAGGACGAACCAACGATAAAGGGTTGGG
GGGGAGGGAGGGTGGGGGATGGACAGCAGGGGTAAAGAGT
GTCCAAAACAATGTGCGTGTTTTAAGATGGCGGTGTGTAT
CGAGTTACAGCAAGAGGGGGGAATAAGCATGAGTGAGAGT
GGTCTCGTGTGATATTGAAACTTTGCTGAGAATTTGAATC
GCTCTCCCTGTTACTCCTCATGTCCCATCAAGCACTAGCA
GCTTAACTCTCACCGTATTGTCGCAAAACCCTTCCTATAT
TTAGTGTCTGCTCATCTACAGGTTCATACACCAATCACAA
CGCCCTCTCCCCTTCACGCGCAGGCACATTTTGATTTCTG
GTAACATTTCCCCTCATTTCTGGATGAATTTTTGCTCATT
TGTCAGACCCAAGTATTTAAACCTGTGCTTCTTATTTAAT
TCACGCAAATGTTATGTTTGGAGAGTTCGACCTTTTGTGC
TTTTTGTGTGTTTCGATCTGTTAGGGGCTGGGGTGGGTTT
GTGTTAGTGGCTGTAAGGTTTTACAAAGGCCCACTTTACT
GATCGCATTTACAGTACGCTGTTGTGTGTAATGAGTATTG
ATATTATAATTATTCTTATTTAGATCCTTCATAATTTTAT
TGGGGTGCAAAAAGGCCGTAGGCTGAATCGTTTTATGTTA
CCGACTTACTCTATAGTGTAAATGCACATGGAACTGACTG
AACTTCAGAATGGGCATGGATGCCATCAGGTTATACCTGC
AAATTATAATACACAGCACATGGTTATGGTGAATTCTGAC
ATACAGTGGTTTCATTGTAAATACATTTTTCCACATGCAT
TGTCGCTTCTTGGAGTGTGTGTTGCATTTCTTTATCATTT
TGTGTTGGAGTTAGTGTCTTGTTTTTGAATCTTTAGTTTG
GAGGCTCAAGTATTCACATTCAGTTCTCTGGTTTTATGTT
TCAATCAAAGAAGAGTGTAAATGCTTTTGTCTTTTTTTTT
TTTCTTTGTGTGCGTGTGTGTGGCATTTTAAAATGGTGGA
AAGAATCATGTATAAAATATTAAGATCAATAAGAATGAAG
CCTTTGGGCACAGTTGCTTAAAAAAGTGAATGTTTAACAC
AAAAGCTGACATTGTGTTCATCCCAAGGGAAAAAAAAAAG
AAACAAACTCCTAATGTTTTTGCAAACTCACTCTTGTCCT
TCTCGGTGATGGCAGTGTTCCTTCACAGTGCTCTTACAAA
AATAACAAACAGAAAGTTACAAACTGAAAATAAAA

Segment Relationships
Protein Products
No data available
Supporting Sequences
Citations